ID: 1005580202

View in Genome Browser
Species Human (GRCh38)
Location 6:27226866-27226888
Sequence AGCTTTCTTTCTTTAGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005580202_1005580205 -10 Left 1005580202 6:27226866-27226888 CCTGTCCCTAAAGAAAGAAAGCT No data
Right 1005580205 6:27226879-27226901 AAAGAAAGCTTAAGCACTTACGG No data
1005580202_1005580206 7 Left 1005580202 6:27226866-27226888 CCTGTCCCTAAAGAAAGAAAGCT No data
Right 1005580206 6:27226896-27226918 TTACGGAGTAGCAGCAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005580202 Original CRISPR AGCTTTCTTTCTTTAGGGAC AGG (reversed) Intergenic