ID: 1005581252

View in Genome Browser
Species Human (GRCh38)
Location 6:27237479-27237501
Sequence CAGCTTCTTCAATTTAAAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005581252_1005581253 -2 Left 1005581252 6:27237479-27237501 CCGACTTTAAATTGAAGAAGCTG No data
Right 1005581253 6:27237500-27237522 TGTTATTTCCGATGTATAGCTGG No data
1005581252_1005581256 24 Left 1005581252 6:27237479-27237501 CCGACTTTAAATTGAAGAAGCTG No data
Right 1005581256 6:27237526-27237548 TGAAGTGACTGCGGCAAAATCGG No data
1005581252_1005581255 15 Left 1005581252 6:27237479-27237501 CCGACTTTAAATTGAAGAAGCTG No data
Right 1005581255 6:27237517-27237539 AGCTGGATGTGAAGTGACTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005581252 Original CRISPR CAGCTTCTTCAATTTAAAGT CGG (reversed) Intergenic
No off target data available for this crispr