ID: 1005581743

View in Genome Browser
Species Human (GRCh38)
Location 6:27241749-27241771
Sequence CTGCTTGCACACACAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005581743_1005581747 7 Left 1005581743 6:27241749-27241771 CCCTCCTCTGTGTGTGCAAGCAG No data
Right 1005581747 6:27241779-27241801 CAACTCCTTCTGTGAACGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005581743 Original CRISPR CTGCTTGCACACACAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr