ID: 1005581924

View in Genome Browser
Species Human (GRCh38)
Location 6:27243353-27243375
Sequence AAGCAAACCCACAATTTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005581921_1005581924 1 Left 1005581921 6:27243329-27243351 CCATAGAGAAGTTACGGGTACTG No data
Right 1005581924 6:27243353-27243375 AAGCAAACCCACAATTTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005581924 Original CRISPR AAGCAAACCCACAATTTTTT GGG Intergenic
No off target data available for this crispr