ID: 1005582462

View in Genome Browser
Species Human (GRCh38)
Location 6:27247926-27247948
Sequence GAGAGCTCTGCCCAGGGCCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 0, 2: 1, 3: 54, 4: 460}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005582456_1005582462 17 Left 1005582456 6:27247886-27247908 CCTTCTTAGGCGCCTGGGTGAGC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1005582462 6:27247926-27247948 GAGAGCTCTGCCCAGGGCCTGGG 0: 1
1: 0
2: 1
3: 54
4: 460
1005582454_1005582462 21 Left 1005582454 6:27247882-27247904 CCTCCCTTCTTAGGCGCCTGGGT 0: 1
1: 0
2: 2
3: 17
4: 426
Right 1005582462 6:27247926-27247948 GAGAGCTCTGCCCAGGGCCTGGG 0: 1
1: 0
2: 1
3: 54
4: 460
1005582457_1005582462 5 Left 1005582457 6:27247898-27247920 CCTGGGTGAGCACATTCAGCAGT 0: 1
1: 0
2: 1
3: 7
4: 108
Right 1005582462 6:27247926-27247948 GAGAGCTCTGCCCAGGGCCTGGG 0: 1
1: 0
2: 1
3: 54
4: 460
1005582450_1005582462 28 Left 1005582450 6:27247875-27247897 CCCACAGCCTCCCTTCTTAGGCG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1005582462 6:27247926-27247948 GAGAGCTCTGCCCAGGGCCTGGG 0: 1
1: 0
2: 1
3: 54
4: 460
1005582455_1005582462 18 Left 1005582455 6:27247885-27247907 CCCTTCTTAGGCGCCTGGGTGAG 0: 1
1: 0
2: 0
3: 4
4: 89
Right 1005582462 6:27247926-27247948 GAGAGCTCTGCCCAGGGCCTGGG 0: 1
1: 0
2: 1
3: 54
4: 460
1005582451_1005582462 27 Left 1005582451 6:27247876-27247898 CCACAGCCTCCCTTCTTAGGCGC 0: 1
1: 0
2: 1
3: 16
4: 217
Right 1005582462 6:27247926-27247948 GAGAGCTCTGCCCAGGGCCTGGG 0: 1
1: 0
2: 1
3: 54
4: 460

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005582462 Original CRISPR GAGAGCTCTGCCCAGGGCCT GGG Exonic
900130116 1:1083825-1083847 GTGAGCCCTGCTCATGGCCTTGG + Intronic
900406787 1:2496288-2496310 GAGAGCTGGGCTCGGGGCCTGGG - Intronic
900637117 1:3671443-3671465 CACAGCCCTGCCCAGGGCCTAGG + Intronic
900648068 1:3717956-3717978 GAGAGCCAGGCCCAGGACCTTGG + Intronic
900783212 1:4631336-4631358 GAGAGGTCTGCCCTTGTCCTCGG - Intergenic
901049951 1:6420947-6420969 GAGGGCTCTGTCCAGGGTGTTGG + Intronic
901506963 1:9690826-9690848 GGTAGCTATGCCCAGGGCCTGGG + Intronic
902334613 1:15747742-15747764 CAGAGCTCAGCACAGGCCCTGGG + Exonic
902545073 1:17184985-17185007 GAGAGCCCTGGCCAGGGATTGGG + Intergenic
903189031 1:21646143-21646165 AAGTGCTGGGCCCAGGGCCTGGG + Intronic
903800219 1:25961694-25961716 CAGTGCTCAGCCCGGGGCCTGGG + Exonic
904422608 1:30403914-30403936 GAGAACTCTCCACAGTGCCTGGG + Intergenic
904826318 1:33276047-33276069 GAGAGCCCTCCCCAAGGCCTGGG - Intronic
904895288 1:33812749-33812771 GAAGGTTCAGCCCAGGGCCTGGG + Intronic
905015714 1:34777150-34777172 TAGAGCTCTGCCCAGGCCTCAGG - Intronic
905272441 1:36795886-36795908 GGGGGCTCAGCCCAGAGCCTGGG + Exonic
905496204 1:38389944-38389966 GGCAGCACTGCCCAAGGCCTTGG - Intergenic
907275129 1:53312740-53312762 GAGAGCAGTGGCCAGGGCTTGGG + Intronic
907702251 1:56800705-56800727 AAGAGCACTGGCCAGGGGCTGGG - Intronic
907724967 1:57011243-57011265 GAGAGCTCTGTCTAGGGGCTGGG + Exonic
908210584 1:61895908-61895930 GACAGAGCTGCCCAAGGCCTTGG + Intronic
909133501 1:71768291-71768313 GACAGAGCTGCCCAAGGCCTTGG + Intronic
909335307 1:74465664-74465686 GGCAGCTCTGCCCACGGCCCTGG + Intronic
909463261 1:75943503-75943525 GAGTACTCTGCCAGGGGCCTGGG + Intergenic
909503610 1:76362782-76362804 GACAGAGCTGCCCAAGGCCTTGG - Intronic
912387933 1:109281827-109281849 GAGAGCGCAGGCGAGGGCCTGGG - Exonic
913396536 1:118377911-118377933 GACAGAACTGCCCAAGGCCTTGG + Intergenic
914000685 1:143691898-143691920 GAGACCTCTCCCCGAGGCCTAGG - Intergenic
914353389 1:146860026-146860048 GAGAGCTGTGGCCAGGGCAGAGG + Intergenic
915114489 1:153587622-153587644 GACAGTTCTCCCCATGGCCTTGG - Intergenic
915901971 1:159854248-159854270 GCGAACCCTGCCCAGGGCCGGGG - Intronic
916077323 1:161209408-161209430 GAGAGGTCTGGGCAGAGCCTGGG - Intronic
916665435 1:166962654-166962676 GAGAGGTCTGCCCTGGGAGTAGG + Intronic
916931799 1:169586420-169586442 GCAAGCGCTGCCCAGGTCCTGGG - Exonic
916995960 1:170301479-170301501 TAGAGAGCTGCCCAGGGACTTGG + Intergenic
917959025 1:180127956-180127978 CTCAGCTGTGCCCAGGGCCTAGG + Intergenic
920211089 1:204328824-204328846 AAGAGCTCAGCACAGTGCCTGGG - Intronic
920572448 1:207027724-207027746 CAAGGCTCTGCCCAGGCCCTGGG + Intronic
922097943 1:222458491-222458513 GAGTGCTCTCCCCAGGCCTTGGG - Intergenic
922229578 1:223674077-223674099 GACAGAACTGCCCAAGGCCTTGG - Intergenic
922572461 1:226642154-226642176 GTGAGCCCTGCCCCAGGCCTCGG - Intronic
922905887 1:229173492-229173514 GAGTGCCCTGCCCTGGGCCTTGG - Intergenic
923553067 1:234979522-234979544 GAGAGCTATTCCCAAGTCCTAGG - Intergenic
923658969 1:235942226-235942248 CAGGGCCCAGCCCAGGGCCTAGG - Intergenic
924832036 1:247606375-247606397 GACAGCTATGCCCAGGACCAAGG + Exonic
1062878940 10:962941-962963 CAGCCCTCTGCCCAGGGTCTCGG - Intergenic
1063100447 10:2945521-2945543 ACCTGCTCTGCCCAGGGCCTGGG + Intergenic
1063375607 10:5552525-5552547 GAGACCTCTGTCCAGGGCGATGG + Intergenic
1063440486 10:6068984-6069006 GGGAGCTCTGCCCAGGCTCTGGG + Intergenic
1064301484 10:14126911-14126933 GACAGCTCTGTGCAGGGCCAAGG - Intronic
1065790134 10:29252985-29253007 GAAAGCTCAGCTCAGTGCCTTGG + Intergenic
1067432789 10:46254843-46254865 CAGAGCATTGCACAGGGCCTGGG - Intergenic
1067440476 10:46306624-46306646 CAGAGTGCTGCACAGGGCCTGGG + Intronic
1067560746 10:47302770-47302792 CAGAGCTATGACCAGGGTCTGGG + Intronic
1067576702 10:47413682-47413704 CAGAGTGCTGCACAGGGCCTGGG + Intergenic
1067712374 10:48659109-48659131 GGGGTCTCTGTCCAGGGCCTGGG + Intergenic
1069551661 10:69368461-69368483 TGGAGCAATGCCCAGGGCCTTGG + Intronic
1069908354 10:71745415-71745437 GAGAGTCCTGCCCTTGGCCTTGG - Intronic
1070194057 10:74140134-74140156 GAGGGCTCCTCCCAGGTCCTTGG - Intronic
1070267066 10:74913806-74913828 GAGAGCTGTGCCCAGTGCCGGGG + Intronic
1071434580 10:85635387-85635409 GGGTCCTCTGCCCTGGGCCTGGG - Intronic
1072412653 10:95217730-95217752 TAGACCTCTCCCCAGAGCCTAGG - Intronic
1072720729 10:97779477-97779499 AAGAGCTTTACCCAGAGCCTGGG - Intergenic
1073206312 10:101771098-101771120 CAGAGCTCGGCCGAGGGGCTGGG + Intronic
1073336481 10:102714196-102714218 CAGTGCTCCGCCCTGGGCCTGGG + Intronic
1073375552 10:103031164-103031186 TAGGGGTCTTCCCAGGGCCTTGG - Intronic
1075007431 10:118840957-118840979 GTGGGCTCACCCCAGGGCCTTGG + Intergenic
1075072368 10:119327547-119327569 GGGACTTCTGCCCAGGGCCTCGG + Intronic
1076351064 10:129815713-129815735 TAGAGAGCTGCTCAGGGCCTCGG - Intergenic
1076904463 10:133355251-133355273 TAGAGCCCTGGCCAGGGCCCAGG + Exonic
1077013889 11:391636-391658 GGCAGCTCTGCCCACGACCTGGG + Intergenic
1077145040 11:1040922-1040944 GAGGGCCCTCCCCAAGGCCTGGG + Intergenic
1077210875 11:1370450-1370472 GGGAGCTCGGCCTGGGGCCTTGG + Intergenic
1077401391 11:2359767-2359789 GAGTGATCAGCCCAGTGCCTGGG + Intergenic
1077408624 11:2393447-2393469 CAGCCCTCAGCCCAGGGCCTAGG + Intronic
1079707331 11:23637387-23637409 GGCAGATCTGCCCAAGGCCTTGG - Intergenic
1080058011 11:27927396-27927418 TAGAGCTCTCCCCAGAGACTTGG + Intergenic
1080894958 11:36441477-36441499 GGCAGAGCTGCCCAGGGCCTTGG - Intronic
1081181728 11:39992434-39992456 GACAGATCTGCCCAAGGTCTAGG + Intergenic
1081549838 11:44100927-44100949 GAGAGCTCTGCACAGTGTCCAGG - Intronic
1081575753 11:44317721-44317743 GACAGCTCTGCCCAGGACAGTGG - Intergenic
1082763835 11:57150883-57150905 GAGTGAGCTGCCCAGGGCCACGG + Intergenic
1083023157 11:59527572-59527594 TAGGGCACTTCCCAGGGCCTTGG + Intergenic
1083150204 11:60787119-60787141 CAGCGCTCTGCACAGGGCCACGG - Intronic
1083197957 11:61102289-61102311 GAGAGCACTGCCCCAGCCCTGGG + Intergenic
1083618375 11:64037090-64037112 CAGAGCTCTGGCTTGGGCCTCGG - Intronic
1083683789 11:64363825-64363847 GAGAGCAGTGCTCAGGTCCTTGG + Intronic
1084210734 11:67620835-67620857 GAGAGTTCTGCTCATGGCCGCGG - Intergenic
1085270538 11:75267328-75267350 GAGAGCCGAGCCCAGGGCCATGG + Intronic
1085593715 11:77789685-77789707 AATTACTCTGCCCAGGGCCTGGG + Intronic
1085953455 11:81362026-81362048 GAGATGTCTGCTCAGGGCCCTGG - Intergenic
1087950746 11:104218340-104218362 GACATCTTTGCCCAGAGCCTGGG - Intergenic
1088694770 11:112357332-112357354 CTCAGCTCTGCCCATGGCCTTGG - Intergenic
1088825689 11:113491953-113491975 GAGAGCTAAGCCCAGGGGCAAGG - Intergenic
1089539678 11:119182294-119182316 GGCAGCTCTGGCCAGGGCCAGGG - Exonic
1089676939 11:120096606-120096628 GACAGCTCTGCCCACAGCCCTGG + Intergenic
1089747404 11:120627010-120627032 GTGGCCTCTGCCCAGGGCCTTGG - Intronic
1089764504 11:120752923-120752945 GAGAGCACAGCCGTGGGCCTAGG + Intronic
1090363153 11:126187073-126187095 GAGAGCTACGGGCAGGGCCTTGG - Intergenic
1090629268 11:128632399-128632421 GAGGGGTCTGCCCAGGCCCAGGG - Intergenic
1090955615 11:131510870-131510892 GGGAGCTCTTCCCACGGCCCAGG - Intronic
1091695640 12:2626351-2626373 GAAAGCTCTCTCCATGGCCTTGG + Intronic
1091907024 12:4197225-4197247 GAGACCTCTGCACAGGGCCCGGG - Intergenic
1092070065 12:5624916-5624938 TAGAGCTCTCCCCAGCCCCTGGG - Intronic
1092264016 12:6967637-6967659 GAGATCTCAGCCCAGCCCCTAGG - Intronic
1092299248 12:7229528-7229550 TAGACCTCTCCCCAGAGCCTGGG - Intergenic
1096292164 12:50352095-50352117 GAGAGGGATCCCCAGGGCCTGGG + Exonic
1096292256 12:50352383-50352405 GAGAGGGATCCCCAGGGCCTGGG + Exonic
1096292285 12:50352491-50352513 GAGAGGCATCCCCAGGGCCTGGG + Exonic
1096292417 12:50352995-50353017 GAGAGTGATCCCCAGGGCCTGGG + Exonic
1096292498 12:50353283-50353305 GAGAGGGATCCCCAGGGCCTGGG + Exonic
1096467549 12:51855789-51855811 GAGAGCACTGCCCAGAGGCCTGG - Intergenic
1097183769 12:57185430-57185452 GAAAGCTCTGCCCTCTGCCTCGG - Intronic
1097253757 12:57656170-57656192 GGCAGCTCTGCCCACGGCCCTGG + Intergenic
1097268827 12:57761757-57761779 GAGAGCTGTGCCCAGCCTCTGGG + Intergenic
1098400171 12:70066570-70066592 GACAGGACTGCCCAAGGCCTTGG + Intergenic
1099925357 12:89010124-89010146 GAGTGCAGTGCCCTGGGCCTTGG + Intergenic
1100230263 12:92599985-92600007 GATGGAACTGCCCAGGGCCTTGG - Intergenic
1100581298 12:95942859-95942881 GAAAGCTGTGCCCAGGGGCAGGG - Exonic
1102022876 12:109696109-109696131 GGAAGCCCTGGCCAGGGCCTAGG - Intergenic
1102438176 12:112941577-112941599 GAGAGCTGTGCCCCGGCCCGAGG - Exonic
1102790666 12:115642582-115642604 TAGAGCTCCTCCCAGGGCCCTGG + Intergenic
1102798072 12:115706700-115706722 AAGAGCTGTTCTCAGGGCCTTGG - Intergenic
1103091896 12:118103755-118103777 GAGGGCTCCTCCCAGGTCCTCGG + Exonic
1103223652 12:119267728-119267750 GGCAGAGCTGCCCAGGGCCTTGG + Intergenic
1103956868 12:124582274-124582296 GGGAGCTGTACCCAGGGCCTGGG - Intergenic
1104190817 12:126480254-126480276 GAGAGTTCTGACCAGAGCCTGGG - Intergenic
1104400418 12:128471486-128471508 CAGAGCTATGCCTAGGGCCAGGG - Intronic
1104960669 12:132487298-132487320 GCAAGCTCTGCCCAGGGCCCTGG + Intergenic
1104973975 12:132543878-132543900 GATAGAGCTTCCCAGGGCCTGGG + Intronic
1105074289 12:133262059-133262081 GGGAGCTCAGAGCAGGGCCTGGG - Intergenic
1105258923 13:18764336-18764358 TAGAGAGCTGCCCAAGGCCTTGG - Intergenic
1105261591 13:18783644-18783666 TAGAGAGCTGCCCAAGGCCTTGG - Intergenic
1105263941 13:18800221-18800243 TAGAGAGCTGCCCAAGGCCTTGG - Intergenic
1105264411 13:18803403-18803425 GTCAGATCTGCCCAAGGCCTTGG - Intergenic
1106136317 13:26976223-26976245 GAGAGCACTGCCGAGGGCTGTGG - Intergenic
1106790801 13:33153385-33153407 GAGAGGGATGCCCAGGGCCTGGG + Intronic
1108362240 13:49678287-49678309 GGTAGCTCTGCCCACGGCCCTGG - Intronic
1108433862 13:50382368-50382390 GAGAGCTCTGACCAGGCCCATGG + Intronic
1111866470 13:93774914-93774936 GAGAGCTCAGCCAAGGCCCCTGG + Intronic
1112155238 13:96809902-96809924 TAGAGCTTGGCACAGGGCCTGGG + Intronic
1112337248 13:98525538-98525560 GAGTGCTGAGTCCAGGGCCTGGG - Intronic
1112742895 13:102495273-102495295 GGGAGAGCTGCCCAAGGCCTTGG - Intergenic
1112790224 13:102995069-102995091 GGCAGATCTGCCCAAGGCCTAGG - Intergenic
1113061091 13:106323329-106323351 GACAGAGCTGCCCAAGGCCTTGG + Intergenic
1113461681 13:110486323-110486345 GAGAGCCCTGCCCAGGGTCAGGG - Intronic
1113778319 13:112961571-112961593 GTGGGCTCTGGCCTGGGCCTGGG - Intronic
1113881008 13:113626199-113626221 GAGAGCTCTCCACAGGGCCAGGG - Intronic
1114193370 14:20457456-20457478 GTGATCACTGCCGAGGGCCTTGG - Exonic
1115224402 14:31088051-31088073 GGGAGCTCTAGCCAGGGCCATGG + Intronic
1117341742 14:54797842-54797864 CAGAGCTCTGCCCTGGTCCTCGG + Intergenic
1118745105 14:68767773-68767795 CAGAGTACTGCTCAGGGCCTTGG - Intergenic
1119020557 14:71108599-71108621 GAGAGCTGTGGCTAGTGCCTAGG - Exonic
1119718115 14:76873123-76873145 GAGAGGTCTGCCCAGGGGTTGGG - Intergenic
1120906095 14:89622596-89622618 GACACCTTTGCCCAGTGCCTAGG - Intergenic
1121710931 14:96039058-96039080 GAGAGCGCTGCCCACAGCCCCGG + Intergenic
1122290935 14:100680188-100680210 GAGAGCTCAGCTCAGAGCCTGGG + Intergenic
1122788055 14:104173003-104173025 GACAGCTCACCCCAGAGCCTGGG + Exonic
1122976473 14:105172897-105172919 GAGCTCTGTGACCAGGGCCTTGG - Intergenic
1123071920 14:105646188-105646210 GAGAGCTCAGCCCCGAGCCCTGG + Intergenic
1123091583 14:105744464-105744486 GAGAGCTCAGCCCTGAGCCCTGG + Intergenic
1123092590 14:105748436-105748458 GTGAGCTCAGCCCTGAGCCTTGG - Intergenic
1123097351 14:105772805-105772827 GAGAGCTCAGCCCCGAGCCCTGG + Intergenic
1123775479 15:23575097-23575119 GACAGGGCTGCCCAAGGCCTTGG + Intronic
1124363969 15:29058663-29058685 AAGAGGTCTGCCCGGGGGCTGGG + Intronic
1127637905 15:60888859-60888881 GAGAGATCTGACCAGGGGATGGG + Intronic
1127973152 15:63977942-63977964 CAGAGGACTGCCCAGTGCCTGGG - Intronic
1129070463 15:72946323-72946345 GAGCACACTGCCCAGGGCCTGGG + Intergenic
1129518368 15:76170673-76170695 TTGGCCTCTGCCCAGGGCCTGGG + Intronic
1129613678 15:77081786-77081808 GAGGGCACTGCCCAGGGGCCAGG + Intronic
1130867494 15:87945106-87945128 GGGAGGTCTTCCCACGGCCTGGG - Intronic
1130972157 15:88741764-88741786 GCACGCTCTGCCCAGGGCTTGGG - Intergenic
1130972340 15:88742527-88742549 TAGAGCCCTGGCCAGGTCCTGGG - Intergenic
1132538384 16:495265-495287 GGGGGCTCTGCCCCGGCCCTGGG - Intronic
1132581334 16:686033-686055 GGCAGCTCTCCCCAGGGGCTGGG - Intronic
1132657100 16:1045960-1045982 GAGCGGGCTGCCCAGGGCCCCGG + Intergenic
1132851136 16:2025549-2025571 GGGAGCCCAGCCCAGGGCCCCGG + Intronic
1133258926 16:4536046-4536068 GAGAGCTCTGCAGAGGACCTTGG - Intronic
1133887557 16:9844669-9844691 CAGAGCTGTGTCCAGGTCCTGGG + Intronic
1134025714 16:10951559-10951581 GAGGCATCTGCCCAGGGCCCTGG - Intronic
1134064773 16:11220976-11220998 GAGTGCTTGGCCCAGGGCTTGGG + Intergenic
1134802825 16:17101154-17101176 GAGGGCTATGCCCAGGGGTTGGG - Intergenic
1135545440 16:23362797-23362819 GAGACCTCGCCCCAGGGCATGGG - Intronic
1136070204 16:27782912-27782934 GAGAGCACTGCTCAGGCTCTGGG - Intergenic
1136234098 16:28903926-28903948 GCTGGCACTGCCCAGGGCCTGGG - Intronic
1137067432 16:35863155-35863177 CAAAGGTCAGCCCAGGGCCTAGG - Intergenic
1137530496 16:49276076-49276098 GATAGCTCTCCCCAGGGACCTGG - Intergenic
1137731492 16:50693665-50693687 GAGTGCTGTGCCCAGCGCCTGGG + Intronic
1138121741 16:54405777-54405799 GAGAGCTCAGCACAGTGACTTGG + Intergenic
1139569223 16:67800260-67800282 GAGACCCCTGCTCTGGGCCTGGG + Intronic
1139917687 16:70438634-70438656 GAGAGCTCTTCCGAGGGCTGGGG + Intronic
1139980634 16:70855492-70855514 GAGAGCTGTGGCCAGGGCAGAGG - Intronic
1141440908 16:84029072-84029094 GTGGACTCTGCCCAGGGCCTTGG - Intronic
1141492456 16:84383307-84383329 GAGAGCTTTGCCCAAGGTCACGG - Intronic
1141594828 16:85090894-85090916 GCCTGCTCTGCCCAGGTCCTGGG - Exonic
1141644816 16:85361728-85361750 GGGGACTCTGCCCAGGGCCCAGG - Intergenic
1141692674 16:85605493-85605515 GAGAGCCATGCCCAGTGCCTGGG - Intergenic
1142231704 16:88903135-88903157 GAGAGATCCACCCAGGGCCACGG + Intronic
1142246245 16:88971456-88971478 GAGAGAGCTGCCTGGGGCCTGGG + Intronic
1142337992 16:89502620-89502642 GAATGCACTGCCCAGGGCCGTGG + Intronic
1142696060 17:1634597-1634619 GGGAGCACTGCCAGGGGCCTGGG + Exonic
1143020877 17:3916693-3916715 TGGAGCTCTGGCCAGGGCCTGGG + Intergenic
1144209041 17:12999535-12999557 AAGAGCTCTGAGCAGGGACTTGG - Intronic
1144498038 17:15762545-15762567 GACAGAGCTGCCCAAGGCCTTGG + Intergenic
1144658229 17:17051671-17051693 GAGAGCTCTGGGTAGGGCATGGG - Intronic
1144737930 17:17565222-17565244 GAGATCTCTGCCCACTGCCCAGG + Intronic
1145370170 17:22301023-22301045 GAGAGGTCAGGCCTGGGCCTCGG - Intergenic
1145907940 17:28526487-28526509 GAGAGCTCTGCACTAGGCCCTGG + Intronic
1146007052 17:29166984-29167006 GAGTGCTTAGCACAGGGCCTTGG + Exonic
1146274573 17:31508577-31508599 GACACCTCTGGCCAGTGCCTGGG + Intronic
1146917402 17:36687011-36687033 AGGAGCCCTGCCCAGGGGCTGGG - Intergenic
1146923209 17:36727521-36727543 GAGAGCTCTCACCAGAGCCTAGG + Intergenic
1147041972 17:37726406-37726428 AGGAACTCGGCCCAGGGCCTGGG + Intronic
1147159357 17:38561519-38561541 CGGAGCTCTTCCCTGGGCCTGGG - Exonic
1147376030 17:40022964-40022986 GGGAGCTCTGGCCAGAGACTGGG - Intronic
1147794616 17:43033591-43033613 CAGAGCTCAACCCAGGCCCTGGG - Intergenic
1148441505 17:47713898-47713920 GAGACCCCTGCCCCTGGCCTGGG + Intergenic
1148442598 17:47719502-47719524 GAGTGCTCTGGGCAGGGGCTGGG + Intergenic
1149998218 17:61416071-61416093 GAGAGGTCTGCCCTGGCCTTGGG - Intergenic
1150392300 17:64797065-64797087 TAGAGCCCTGCCCAGGGCTGTGG + Intergenic
1150411057 17:64940914-64940936 CGGAGCTCTGCCCAGGGCTGTGG - Intergenic
1152135385 17:78500353-78500375 CAGGGCTCTGCCCAGGTCCTTGG + Exonic
1152206194 17:78975975-78975997 GGCAGCTCTGCCCAGAGCCTGGG + Exonic
1152299500 17:79486749-79486771 GAGGGCTGTGCCCTGGGGCTTGG + Intronic
1152637821 17:81437371-81437393 CAGAGCTCTGCCAGTGGCCTGGG + Intronic
1152828757 17:82484253-82484275 GTGCTCTCTGCCCAGTGCCTGGG - Intronic
1154423982 18:14258158-14258180 GTCAGATCTGCCCAAGGCCTTGG + Intergenic
1154432121 18:14316392-14316414 TAGAGAGCTGCCCAAGGCCTTGG + Intergenic
1155109710 18:22702170-22702192 GACAGCACTGCACAGGCCCTGGG - Intergenic
1156352347 18:36311963-36311985 GACAGCTGGGCCCAGGGCCAGGG - Intronic
1156405081 18:36775802-36775824 GAGAACTGTCACCAGGGCCTGGG + Intronic
1156617056 18:38799534-38799556 GAAAGCTTTGCCCAGGACCTTGG - Intergenic
1157594814 18:48858133-48858155 CAGAGATCTGCCCAGGGACTGGG - Intronic
1158960336 18:62582865-62582887 AAGTGATCTGCCCAAGGCCTTGG - Intronic
1159633616 18:70779131-70779153 CAGAGCTCTGGCCAGGAGCTAGG + Intergenic
1160370634 18:78369647-78369669 GTGAGCTCTGCCCAGGGCAGTGG + Intergenic
1160743385 19:698277-698299 GAAAGCTGTTTCCAGGGCCTGGG + Intergenic
1161230336 19:3171887-3171909 GAGAGCTCAGTCCAGGGATTAGG + Intergenic
1162782131 19:13011911-13011933 GGGAGGTCTCCCCAGGGCCCAGG + Intronic
1163252553 19:16134824-16134846 TAAAGCTCTCCCCAGGGGCTGGG + Intronic
1163721659 19:18900781-18900803 GGCAGGTCTGCCCATGGCCTCGG - Intronic
1163908107 19:20165157-20165179 AAGTGCTCTGCCCACTGCCTCGG - Intergenic
1164583033 19:29446730-29446752 GAGGCGGCTGCCCAGGGCCTGGG + Intergenic
1164719807 19:30423971-30423993 GAGGGCACTGCCCAGACCCTGGG - Intronic
1164945330 19:32288480-32288502 GAGGGCTCCCTCCAGGGCCTGGG - Intergenic
1165055610 19:33174441-33174463 GGGGCCTCTGCCCATGGCCTAGG + Intronic
1165410575 19:35658348-35658370 GACAGCTCTGCAGTGGGCCTGGG + Intronic
1166108641 19:40609982-40610004 GACTGCTCTGCCCTGGCCCTTGG + Intronic
1166286916 19:41836837-41836859 GAGAGATTTGGCCAGGGTCTCGG + Intergenic
1166315154 19:41985446-41985468 GAGGGTTCAGTCCAGGGCCTGGG + Intronic
1167528549 19:50000680-50000702 GAGAGCTCGGCCGGGGGCCAGGG - Intronic
1167744350 19:51341902-51341924 AAGAGCTCTTCCCAGGGGCTGGG - Exonic
1168115702 19:54220457-54220479 GAGAGCTCTCCTGGGGGCCTGGG + Intronic
1168118689 19:54240203-54240225 GAGAGCTCTCCTGGGGGCCTGGG + Intronic
1168405503 19:56108313-56108335 GGGAGCTCTGGGCAGGGGCTGGG - Intronic
1168405544 19:56108418-56108440 GAGAGCTCTGGGCAGGGGCAGGG - Intronic
1168649700 19:58085406-58085428 GAGCGCCCCGCCCAGGGCCAGGG + Intronic
925031115 2:650387-650409 GAGAGCAAAGCCCATGGCCTGGG - Intergenic
926300294 2:11597128-11597150 GAGGGCACTGGCGAGGGCCTCGG + Intronic
926320356 2:11744995-11745017 GAGAGCTTTGTCCAGGGGCGCGG - Intronic
926549821 2:14288117-14288139 CAGAGCTCTCCCTAGTGCCTGGG - Intergenic
927086339 2:19677073-19677095 GACAGATCTGCTCAGGGCCCTGG + Intergenic
927207178 2:20618085-20618107 GGGAGCCCTGCCCAGGCCCCAGG + Exonic
927257108 2:21049098-21049120 GAAAGCTCTGTCCCTGGCCTGGG - Intergenic
927520010 2:23692972-23692994 GAGAGCCCTGCTCAGAGCCTGGG - Intronic
927785495 2:25971466-25971488 AATAGCTCAGCCCAGGGCCTGGG + Intronic
927856273 2:26529810-26529832 GAGGGTTCTGAGCAGGGCCTAGG + Intronic
927930483 2:27040499-27040521 GAGACCTTTGCCCAGGGCTCCGG + Intronic
928439858 2:31283387-31283409 AAGAGGGCTCCCCAGGGCCTTGG + Intergenic
928450705 2:31375615-31375637 GAGCTGTGTGCCCAGGGCCTCGG + Intronic
929429760 2:41877315-41877337 GAGGGCCCTGCCCAGGGCTCTGG + Intergenic
930593460 2:53356837-53356859 GGCAGCTCTGCCCATGGCCCTGG + Intergenic
930604038 2:53473942-53473964 GAGAGCCCTGACTAGGGCCCTGG + Intergenic
930687591 2:54325864-54325886 GACAGAGCTGCCCAAGGCCTTGG + Intergenic
934777731 2:96949802-96949824 CAGAGCTCTGCTCTGGGCCTGGG - Intronic
934900309 2:98154620-98154642 GTGGGCTCAGCCCAGGGCTTGGG + Intronic
935131996 2:100267577-100267599 AAGAGCTCTGCACGGGGCCCAGG - Intergenic
935255768 2:101308484-101308506 GAGAGCCCGGCCCCGGGCCCCGG + Exonic
935946369 2:108289992-108290014 CACAGCTGTGCCCAGGCCCTCGG + Intronic
936093359 2:109514823-109514845 GACCGCCGTGCCCAGGGCCTGGG - Intergenic
937333698 2:121047564-121047586 TGGAGCTCTGCCCAGGACCGGGG + Intergenic
937363573 2:121245277-121245299 AAGAGCCCCGCCCAGAGCCTCGG + Intronic
937904439 2:127046030-127046052 AGGAGCCCTGCCCAGGGTCTGGG + Intergenic
937914422 2:127092045-127092067 GAGAGCTGGGCCAAGAGCCTGGG - Intronic
938331017 2:130448186-130448208 TACAGATCTGCCCAAGGCCTTGG - Intergenic
938358931 2:130673317-130673339 TACAGATCTGCCCAAGGCCTTGG + Intergenic
938941737 2:136175691-136175713 CAGAGCTCAGCCCAGCTCCTGGG + Intergenic
939243662 2:139594898-139594920 GACAGAGCTGCCCAAGGCCTTGG + Intergenic
941436846 2:165483137-165483159 GAATGCCCTGCCCAGAGCCTAGG - Intronic
941471034 2:165887150-165887172 GAGATCACTGTCCAGGGCTTTGG + Intronic
943134512 2:183892942-183892964 GGCAGCTCTGCCCATGGCCCTGG + Intergenic
943184097 2:184583648-184583670 GAGAGTGGTGCCCAGGGTCTGGG + Intergenic
945515822 2:210762483-210762505 GAAAGAGCTGCCCAAGGCCTTGG - Intergenic
946193690 2:218021164-218021186 GAGAGCTCTGCACAGCCCTTGGG + Intergenic
947441334 2:230124383-230124405 TAGAACTCTGCCCAGTGGCTGGG - Intergenic
947472163 2:230410364-230410386 ATGAGCTCTTCCCAGGGCCAAGG - Intergenic
947804159 2:232953621-232953643 GGGAGATCTGCCCAGAGCCGGGG + Intronic
948305619 2:236944851-236944873 GAGGGCTCTTCTCAGGGCCAGGG + Intergenic
948349547 2:237327385-237327407 GAGAGGTCTGCCCAGAGCCACGG + Intronic
948564612 2:238875995-238876017 GTGAACCCTGGCCAGGGCCTCGG - Intronic
1169291809 20:4359289-4359311 GAGAAGTTTGCACAGGGCCTGGG - Intergenic
1170336625 20:15277268-15277290 GAGAGGTCTGCTGAGGACCTTGG - Intronic
1170921425 20:20683249-20683271 GTGACCTCTGCCCATTGCCTGGG + Intronic
1171378257 20:24710478-24710500 GAGCGCTATGCCCAGTGCCGGGG - Intergenic
1171393540 20:24816453-24816475 GTGATCTCAGCCCAGGGCCAGGG + Intergenic
1171544075 20:25987436-25987458 GAGAGGTCAGGCCAGAGCCTCGG - Intergenic
1172134978 20:32680820-32680842 GAGAGCTCTGCAAAGGCCCCAGG + Intergenic
1172213203 20:33215401-33215423 GAGGGCCCTGCTCAGGGGCTGGG - Intergenic
1172449946 20:35014918-35014940 GAGAGCTCTGAACAGGACATTGG - Intronic
1175574792 20:60052697-60052719 GAGAGCTTTGCCCAGCTCCCTGG + Intergenic
1175780601 20:61679925-61679947 GTGGGAACTGCCCAGGGCCTCGG + Intronic
1175797470 20:61780985-61781007 GTAAGCTCTGCCCAGATCCTTGG + Intronic
1176203397 20:63874761-63874783 GAGAGCACTGATCAGGTCCTTGG + Intronic
1176844918 21:13869362-13869384 TAGAGTGCTGCCCAAGGCCTTGG - Intergenic
1176847650 21:13888922-13888944 TAGAGAGCTGCCCAAGGCCTTGG - Intergenic
1176849487 21:13901845-13901867 GTCAGATCTGCCCAAGGCCTTGG - Intergenic
1178205175 21:30456384-30456406 GACAGAGCTGCCCAAGGCCTTGG - Intergenic
1178349998 21:31866110-31866132 AAGAGCCCTGCCCAGGGCCACGG + Intergenic
1178918600 21:36723574-36723596 GAAAGCTCTGCCTTGGACCTTGG - Intronic
1179173948 21:38993844-38993866 AAGAGGTCTGCCCAGAGCCAAGG - Intergenic
1180057080 21:45364615-45364637 GTGAGCTCAGCCCGGGACCTGGG + Intergenic
1181035037 22:20165747-20165769 CAGAGCCCTGCTCAGGGCCCAGG + Intergenic
1181109258 22:20591744-20591766 GAGGGCACCGCCCCGGGCCTAGG + Intergenic
1181508784 22:23379612-23379634 CAGAGCTCTGCCCAGGGCCCAGG - Intergenic
1181539720 22:23566718-23566740 CTGAGCTCTGCCAAGGGCCGGGG + Intergenic
1181568553 22:23753842-23753864 GACAGCTCTGCCCTTGACCTGGG - Intronic
1181575615 22:23792585-23792607 TAGAGAGCTGCCCTGGGCCTGGG + Intronic
1182695804 22:32198709-32198731 GAGGTCTTTGCCCAGGGCCCGGG - Intronic
1183042347 22:35191737-35191759 GAGATCAGTGCCCAGGGCATTGG - Intergenic
1183659426 22:39210013-39210035 GAGAGCTTTGCCCAGAGCTATGG + Intergenic
1183770121 22:39917237-39917259 GAGAGCTTTGCACTGGGCCAGGG - Intronic
1184128478 22:42503314-42503336 GGGAGCGCTGCCCGGGGCCCAGG - Intergenic
1184137273 22:42556629-42556651 GGGAGCGCTGCCCGGGGCCCAGG - Intronic
1184211938 22:43041108-43041130 TAGAGGTTTGCTCAGGGCCTAGG + Intronic
1184342408 22:43893281-43893303 GAATGCTCAGCCCATGGCCTGGG + Intergenic
1184692785 22:46124814-46124836 GGGAGGAATGCCCAGGGCCTTGG + Intergenic
1184782379 22:46655762-46655784 GTGGCCTCTGCCTAGGGCCTTGG - Intronic
1185067585 22:48639850-48639872 CAGAGCCCTGCCCAGACCCTGGG - Intronic
1185342779 22:50299158-50299180 GAGAGCTCGGGCCTAGGCCTGGG + Intronic
949777464 3:7648691-7648713 GACTTCTCTGCCCAGGTCCTAGG - Intronic
951072692 3:18351186-18351208 GTGAGCTCTGCCCAAGACCATGG + Intronic
951155586 3:19349405-19349427 GAGAACTTTGACCAGGGCATGGG - Intronic
953236375 3:41111108-41111130 CAGAGCTCTGCCCAGACCCCAGG + Intergenic
953669769 3:44952540-44952562 AAGAGCCCTGCCCAGGAGCTTGG - Intronic
953877969 3:46677079-46677101 CAGGACTCTGCCCAGGCCCTTGG + Intronic
953899974 3:46834316-46834338 CAGAACCCTGCCCAGGGCCAAGG + Intergenic
954418472 3:50405821-50405843 GAGAGATCTGGCCCTGGCCTGGG - Intronic
955328276 3:58026319-58026341 GAAAGTGCTGCCCAGGGCCAAGG - Intronic
959873987 3:111360412-111360434 GACAGAGCTGCCCAAGGCCTTGG + Intronic
960593794 3:119390420-119390442 GAAAACTCTGCCCAGTGCTTCGG - Intronic
960919175 3:122729265-122729287 GACAGCTCTGGCCAGGGCTCTGG + Exonic
960941971 3:122940810-122940832 GAGAGCTCTGCTAAGGACTTGGG - Intronic
962177170 3:133167353-133167375 GGCAGCTCTGCCCATGGCCCTGG - Intronic
962256221 3:133871929-133871951 CAGAGCTGGGCTCAGGGCCTAGG + Intronic
965089943 3:164149369-164149391 GATGGAGCTGCCCAGGGCCTTGG - Intergenic
965850893 3:173021645-173021667 CAGAGCTTTGTCCAGGGACTGGG + Intronic
966050788 3:175616624-175616646 GTGACCTCTGCCTGGGGCCTGGG + Intronic
966509821 3:180749442-180749464 GAGAGCTTTTCCCAGAGCGTAGG - Intronic
967968526 3:194982974-194982996 GAAAGTTCAGCACAGGGCCTGGG - Intergenic
968077776 3:195825732-195825754 GAGTCCTCTGCCCTGGGCCAGGG - Intergenic
968453717 4:686935-686957 GTGGGCTCTGGCCAGGTCCTTGG - Intronic
968547211 4:1205471-1205493 GAGAGCCGTGCCCAGCACCTGGG + Intronic
968578488 4:1378886-1378908 GAATGTGCTGCCCAGGGCCTTGG - Intronic
971045637 4:22802325-22802347 GATCACACTGCCCAGGGCCTTGG + Intergenic
971158063 4:24104317-24104339 GAGAGATCTGTGCAGGTCCTTGG + Intergenic
971480922 4:27114423-27114445 GAGAGCTGTACGCAGGCCCTGGG - Intergenic
972197560 4:36672482-36672504 GAGAGGTCTTACCATGGCCTGGG - Intergenic
973368888 4:49229414-49229436 GGCAGATCTGCCCAAGGCCTTGG - Intergenic
973392158 4:49566001-49566023 GGCAGATCTGCCCAAGGCCTTGG + Intergenic
977372667 4:96159764-96159786 GGGATCTCTTCCCAGGGCCCAGG - Intergenic
977557269 4:98498636-98498658 GACACCACTGCCCAGGGCCTGGG + Intronic
977641243 4:99360083-99360105 GGCAGCTCTGCCCACGGCCCTGG + Intergenic
978809164 4:112831213-112831235 GGCAGCTCTGCCCACGGCCCTGG + Intronic
979804830 4:124958433-124958455 GAGATCTCATCCCAGTGCCTTGG + Intergenic
982834639 4:160109008-160109030 GATAGAGCTGCCCAAGGCCTGGG - Intergenic
983243230 4:165257491-165257513 GAGAGGTATGGCCAGGGGCTGGG + Intronic
984961266 4:185100516-185100538 GAGAGCATTGCCCAGGGGCCGGG + Intergenic
985339838 4:188938893-188938915 GACAGCTTTTCCCAGGACCTGGG + Intergenic
985653096 5:1116063-1116085 GAGAATTCTGCCCATGGCCAGGG + Intergenic
985663475 5:1169260-1169282 GGCAGCTCTGTCCAGGGCCCAGG - Intergenic
986385375 5:7228032-7228054 GAAAGCTCTGCCCTGGGCAGGGG + Intergenic
986648962 5:9945256-9945278 GTGAGCTCTGCCCAGAGCTCTGG - Intergenic
986952785 5:13111619-13111641 GAAAACTCTGCCCAAGGCCTTGG + Intergenic
987079188 5:14411072-14411094 GAGAGCGCTGAGCCGGGCCTGGG + Intronic
987488747 5:18551649-18551671 GGCAGCTCTGCCCATGGCCCTGG - Intergenic
988040884 5:25887931-25887953 GACAGAGCTGCCCAAGGCCTTGG - Intergenic
988227139 5:28426817-28426839 GACAGAGCTGCCCAAGGCCTTGG + Intergenic
988310271 5:29548262-29548284 GGCAGACCTGCCCAGGGCCTTGG - Intergenic
988759445 5:34297470-34297492 GATAGAACTGCCCAAGGCCTTGG + Intergenic
990401325 5:55440313-55440335 GAGAGCTCTTCCCAGAGCATGGG - Intronic
990510891 5:56488072-56488094 GGCAGCTCTGCCCGGGGCCCTGG + Intergenic
990668426 5:58099943-58099965 GTGAGCACTGAGCAGGGCCTGGG - Intergenic
992048939 5:72925895-72925917 GGCAGCTCTGCCCACGGCCCCGG + Intergenic
992560310 5:77945875-77945897 GTGACCTCAGCCCAGGGTCTGGG + Intergenic
993022273 5:82605776-82605798 GAGCACTCTGCCAAGGCCCTGGG + Intergenic
993257826 5:85616481-85616503 GACAGGGCTGCCCAAGGCCTTGG - Intergenic
993983745 5:94572958-94572980 GAGAGCTGTGCCATGGGCCATGG - Intronic
994491159 5:100445339-100445361 AAGACCCCTGCCCAAGGCCTCGG + Intergenic
996092521 5:119364683-119364705 GAGAGCTCTAGCCAGGAGCTAGG + Intronic
996605181 5:125313262-125313284 GATAGAGCTGCCCAAGGCCTTGG - Intergenic
997206475 5:132053292-132053314 GAGAGCTGGGCTCAGGTCCTGGG - Intergenic
997228848 5:132228459-132228481 GAGAGCTCGGCCCTGGGAATGGG - Intronic
999774932 5:154804448-154804470 GAAAGCTCAGCCCAGGACCTGGG + Intronic
1001093120 5:168756239-168756261 CAGAGCTCAGACCAGGGACTTGG - Intronic
1001194835 5:169663239-169663261 GGGAGAGCTGCCCAAGGCCTTGG - Intronic
1001422285 5:171596905-171596927 GAGAGGGGCGCCCAGGGCCTGGG + Intergenic
1001822251 5:174719511-174719533 GAGAGCTGTACCCAGGGATTGGG + Intergenic
1002104798 5:176874719-176874741 GACAGCTCTGGCCACGGCCTCGG - Intronic
1002163374 5:177330409-177330431 GAGAGCTCGTCTCTGGGCCTCGG + Intergenic
1002374776 5:178780819-178780841 GCCACCTCTGCCCAGGGCCCCGG - Intergenic
1002392748 5:178928606-178928628 GGCAGATCTGCCCAAGGCCTAGG - Intronic
1002416797 5:179124994-179125016 GCGAGCTCTGCCCTGGTCGTTGG - Exonic
1002570246 5:180136049-180136071 CAGAGCCCTGTCCTGGGCCTTGG - Intronic
1002597846 5:180335657-180335679 CAGAGCTCTGCCAGTGGCCTGGG - Intronic
1003036406 6:2644181-2644203 GAGAGCTCTGGCCACTGACTTGG + Intergenic
1004182333 6:13391819-13391841 GAGAGCTTAGCACAGGGTCTGGG + Intronic
1004681582 6:17900781-17900803 GAGAGCTCAGTCCAGGGGCCAGG + Intronic
1005582462 6:27247926-27247948 GAGAGCTCTGCCCAGGGCCTGGG + Exonic
1006043378 6:31272315-31272337 GAGAGCCCCGCCCGGGACCTGGG + Intronic
1006402310 6:33824995-33825017 CAGAGCTCAGCCCAGGGACTGGG - Intergenic
1006453705 6:34120271-34120293 GAGGCCTCAGCACAGGGCCTGGG + Intronic
1006848682 6:37081479-37081501 GAGAGATCATCCCAGGGGCTGGG - Intergenic
1007171258 6:39865137-39865159 CAGAGCACTGCACAGGGCTTCGG - Intronic
1007477327 6:42127581-42127603 GAGAGCTCAGACCAGGGCAAGGG + Intronic
1007719946 6:43878991-43879013 AGGATCTCTGCCCATGGCCTTGG + Intergenic
1008507791 6:52247469-52247491 CAGAGCTCTGCGCATGGACTTGG + Intergenic
1009943133 6:70312644-70312666 GAGAGCCCTGGCGAGGCCCTTGG - Intergenic
1010367728 6:75071475-75071497 GAGACCACTTCTCAGGGCCTGGG + Intergenic
1011345862 6:86369056-86369078 GACAGAGCTGCCCAAGGCCTTGG + Intergenic
1012598420 6:101066623-101066645 GGAAGCTCTGCCCACGGCCCTGG - Intergenic
1014079513 6:117270771-117270793 GAGGGCGCCGCCCAGGGCGTAGG - Exonic
1014089512 6:117387803-117387825 GAGGGCTCTGACCAGGGGCCTGG + Exonic
1015936190 6:138407716-138407738 GATGGAGCTGCCCAGGGCCTTGG - Intronic
1017031800 6:150230366-150230388 GAGCCATCTGCCCTGGGCCTGGG - Intronic
1018650112 6:165986209-165986231 GACATCTCTGCCCAGGGCTGGGG + Intronic
1019283544 7:212048-212070 GGGGGCTGTGCCCAGGGCCTGGG + Intronic
1019461418 7:1160763-1160785 GTTGGCTCTGCCCAGGGCCGCGG + Intergenic
1019472881 7:1230442-1230464 GAGAGCTCTTCAGAGGCCCTCGG - Intergenic
1019475622 7:1242765-1242787 GAGAGCTCGGCCTGGGGCCACGG + Intergenic
1019683513 7:2366736-2366758 AAGAGCTCTGCCCAGAGCAGGGG - Intronic
1022473928 7:30698269-30698291 GAGAGCTAGGCGCAGGGCCTGGG + Intronic
1022508689 7:30922078-30922100 GTGAACTCGGGCCAGGGCCTGGG + Exonic
1023690350 7:42779640-42779662 GACAGAGCTGCCCAAGGCCTTGG + Intergenic
1024297578 7:47857741-47857763 CAGAGCTCTGTCCAGAGCCTGGG - Exonic
1024569023 7:50709232-50709254 GATGGCTCAGCACAGGGCCTGGG - Intronic
1024698833 7:51884739-51884761 GAAAGCCCTGCCCAGGTCCCGGG - Intergenic
1024899086 7:54296423-54296445 GAGAGCTCTGACAAGTGCTTTGG - Intergenic
1025295456 7:57772520-57772542 GAGAGGTCAGGCCAGAGCCTCGG - Intergenic
1026895998 7:74010397-74010419 GAGACCTCCCCCCAGGGGCTGGG + Intergenic
1026988541 7:74569944-74569966 GAGAGACCTGCCCGGGGCATCGG + Intronic
1027180363 7:75935130-75935152 GACAGAGCTGCCCAGGACCTTGG + Intronic
1029618225 7:101673442-101673464 GAGTGATCTGGCCAGGCCCTGGG - Intergenic
1029629963 7:101743995-101744017 GCCAGCTCTGCTCAGGGCCTGGG - Intergenic
1033681693 7:143601432-143601454 GCCAGCTCTCCCCAGGGCCCTGG - Intergenic
1033703198 7:143860381-143860403 GCCAGCTCTCCCCAGGGCCCTGG + Exonic
1034420929 7:150990320-150990342 AAGAGCTGTCCCCGGGGCCTTGG + Intergenic
1034763531 7:153696144-153696166 GAGAGCTCCACCTGGGGCCTGGG + Intergenic
1034941458 7:155233104-155233126 GAGAGCCGTGTGCAGGGCCTGGG - Intergenic
1035185591 7:157123401-157123423 GAGAGCTCTGCGCCAGGCCTTGG + Intergenic
1035394739 7:158527491-158527513 GAGAGGCCAGCCCATGGCCTGGG - Intronic
1035402252 7:158574544-158574566 AAGAGCCCTGTCCAGGGCTTGGG + Intronic
1035496614 7:159333304-159333326 GGGAGCTCAGAGCAGGGCCTGGG - Intergenic
1038572716 8:28676697-28676719 CAGGGCTCTGTCCTGGGCCTTGG - Intronic
1039890283 8:41681379-41681401 GAGAGGACGGCCCAGGCCCTGGG - Intronic
1043246241 8:78005729-78005751 GAGTTTTCTTCCCAGGGCCTGGG - Intergenic
1044525464 8:93246417-93246439 CACAGCTCTGACCAGAGCCTGGG - Intergenic
1044528185 8:93276085-93276107 GAGGACTCTTCCCCGGGCCTTGG - Intergenic
1046056196 8:109082042-109082064 GATGGATCTGCCCAAGGCCTTGG - Intergenic
1047288516 8:123508600-123508622 GAGAGCTCTGCCCAGCAGCCTGG - Intronic
1047418424 8:124685460-124685482 GAGAGCTCTGCCCAGAATCTGGG - Intronic
1047649080 8:126900366-126900388 GGCAGATCTGCCCAAGGCCTTGG + Intergenic
1048305086 8:133278500-133278522 TGGAGCTCTGGCCAGGGCATGGG + Intronic
1048817659 8:138348952-138348974 GAGAGTTGTGGCCAGGGCCCAGG + Intronic
1049238942 8:141526863-141526885 GTGAGCTCAGCTCTGGGCCTGGG - Intergenic
1049266000 8:141668235-141668257 GGGAGCTCGGCTCAGTGCCTGGG - Intergenic
1049306849 8:141908484-141908506 GAGAGCCCTGCCCAAGGACTAGG - Intergenic
1049310950 8:141933604-141933626 GAGAGCTCACCCCAGGCTCTGGG - Intergenic
1049351169 8:142165543-142165565 GCCAGCCCAGCCCAGGGCCTTGG + Intergenic
1049748871 8:144274278-144274300 GCCAGCTCTGCCCAGTGCCGAGG + Intronic
1050189586 9:3010659-3010681 GAGAACTCTGCCCAGGTGCCAGG + Intergenic
1050388226 9:5111972-5111994 GTGGGCTCCCCCCAGGGCCTGGG + Intronic
1051148955 9:14060050-14060072 GAGGGCTCTGGTGAGGGCCTTGG + Intergenic
1052686583 9:31764890-31764912 GACAGACCTGCCCAAGGCCTTGG - Intergenic
1053268622 9:36734584-36734606 GAGATCTCAGCCCTGGGCTTTGG + Intergenic
1055084411 9:72299486-72299508 GGGTGCTCTGCCTAGTGCCTAGG - Intergenic
1056969581 9:91191186-91191208 AAGAGAGCTGCCCAGGGGCTGGG - Intergenic
1057227981 9:93302459-93302481 GAAAGCTCTCCCCAGGCCCTAGG - Intronic
1057645847 9:96874803-96874825 GGGAGCTGGGACCAGGGCCTGGG + Intronic
1059231551 9:112725773-112725795 GGCAGGCCTGCCCAGGGCCTTGG - Intergenic
1060019628 9:120117842-120117864 GACAGGGCTGCCCAAGGCCTTGG + Intergenic
1060283072 9:122226995-122227017 CAGAGCTCCTGCCAGGGCCTCGG + Exonic
1060441246 9:123641576-123641598 GAGAGCTTTGACTGGGGCCTTGG - Intronic
1060551793 9:124489115-124489137 CAGAGCTATGCACAGGGCTTTGG + Intronic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1060826162 9:126689217-126689239 GAGTGCTCTGGCCAGTGCCCAGG + Intronic
1061089584 9:128419464-128419486 AAGAGCTCCGCCCTGGGGCTGGG - Intronic
1061275880 9:129569182-129569204 CTGAGCTCTGCCAAGGGCCGGGG + Intergenic
1061398100 9:130354399-130354421 CAGAGCTCTGTCCCGGCCCTGGG + Intronic
1061498540 9:130989611-130989633 GAGGATTCTGCCCAGGGCCCAGG + Intergenic
1061860829 9:133468043-133468065 GAAGGCCCTGCCCAGGGGCTGGG - Intronic
1062101508 9:134730944-134730966 GAAAGCTCTGCCCGAGACCTTGG + Intronic
1062193063 9:135257508-135257530 GCCAGCTCTCCCCAGGGCCTAGG - Intergenic
1062435911 9:136546481-136546503 CAGAGCCCTGCCCCGGGCCCGGG - Intergenic
1062730207 9:138104309-138104331 AAGAGCTCCGCCCAGGGCACTGG - Intronic
1186484721 X:9925193-9925215 GTAAGAGCTGCCCAGGGCCTGGG + Intronic
1189166552 X:38866621-38866643 GGGACCTCTGCCTGGGGCCTGGG + Intergenic
1190595882 X:52052391-52052413 GAGACCTCTGCCCAGACCATGGG - Exonic
1190612942 X:52201682-52201704 GAGACCTCTGCCCAGACCATGGG + Exonic
1192205809 X:69095295-69095317 GCAACCTCTGCCCAGGGCCAGGG - Intergenic
1193871527 X:86804860-86804882 GGCAGATCTGCCCAAGGCCTTGG - Intronic
1194535524 X:95102031-95102053 GAAAGCTTGGCCCAGGACCTTGG + Intergenic
1195814166 X:108867395-108867417 GACAGAGCTGCCCAAGGCCTTGG - Intergenic
1200092079 X:153640701-153640723 GACAGCTGTGCCCATGGCCTGGG - Intergenic
1200145262 X:153923085-153923107 GGGAGCTCTGCCCAGACCCCGGG - Intronic
1200401513 X:156022874-156022896 AAGAGCTCTGGCAAGGCCCTGGG - Intergenic
1200621458 Y:5454299-5454321 GACAGAGCTGCCCAAGGCCTTGG - Intronic