ID: 1005583210

View in Genome Browser
Species Human (GRCh38)
Location 6:27252051-27252073
Sequence TAACTCCTCCCAGCTGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005583210_1005583217 20 Left 1005583210 6:27252051-27252073 CCTGGCACAGCTGGGAGGAGTTA 0: 1
1: 0
2: 2
3: 26
4: 206
Right 1005583217 6:27252094-27252116 CACTTCCGTTGTGTGATCTTGGG 0: 1
1: 0
2: 1
3: 18
4: 211
1005583210_1005583216 19 Left 1005583210 6:27252051-27252073 CCTGGCACAGCTGGGAGGAGTTA 0: 1
1: 0
2: 2
3: 26
4: 206
Right 1005583216 6:27252093-27252115 CCACTTCCGTTGTGTGATCTTGG 0: 1
1: 0
2: 3
3: 14
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005583210 Original CRISPR TAACTCCTCCCAGCTGTGCC AGG (reversed) Intronic
900777305 1:4594646-4594668 TCACTCCTCCCCACTGAGCCTGG - Intergenic
901649785 1:10736959-10736981 AAATTCCTCCCACCTGGGCCAGG - Intronic
901681319 1:10914455-10914477 TCCCTCCTCCCACCTGTGCCTGG - Intergenic
901800979 1:11707842-11707864 TGGCTCCTCCCAGCCTTGCCTGG + Intronic
902887177 1:19413876-19413898 TCACTCCACACAGCTGTCCCTGG + Intronic
903357248 1:22755765-22755787 TAAATGCTTCCAACTGTGCCTGG + Intronic
903770325 1:25759655-25759677 TGTTTCCTCACAGCTGTGCCAGG - Intronic
904608570 1:31712716-31712738 CTCCTCCTCCCAGCAGTGCCTGG + Intergenic
905509863 1:38510573-38510595 TTAGTCCCCCCAGCTGTGCGAGG - Intergenic
908178786 1:61583405-61583427 TAACTCCCCCCAGTTGTTCTTGG - Intergenic
913066405 1:115259792-115259814 TCACTACCCCCAGCTGTTCCTGG - Intergenic
914419807 1:147518908-147518930 GCACTCCCCCCAGCTATGCCTGG - Intergenic
914490425 1:148147651-148147673 TGACTTCTCAGAGCTGTGCCTGG - Intronic
916747375 1:167694887-167694909 TACCTCCTCCCAGCAGGGCGAGG - Intronic
918119249 1:181523248-181523270 CCACTCCCCCCAGCTGTGACTGG + Intronic
919731261 1:200915021-200915043 TAAGACCACCCAGCTGTCCCTGG + Intronic
921110621 1:212033424-212033446 GCACTCCTCCCAGCAATGCCTGG - Intronic
924589481 1:245389475-245389497 TAACTCATTCCAGTTCTGCCAGG - Intronic
1063120609 10:3103283-3103305 TAACTGCTGCCAGCTTTGTCTGG + Intronic
1063700756 10:8382899-8382921 TGACTCTTCCCAGCTTTGGCTGG - Intergenic
1063812137 10:9723331-9723353 CAACTCCTCACAGCTGTCCATGG + Intergenic
1064092162 10:12394632-12394654 TACCACCTCCCAGGTGTGGCAGG - Intronic
1064263322 10:13803896-13803918 TCACTCCGCTCACCTGTGCCAGG + Intronic
1068511611 10:57972954-57972976 TAATAGCTCCCAGATGTGCCCGG - Intergenic
1069934344 10:71905072-71905094 TAACCCTTCCCAGCTGTGGTCGG + Intergenic
1070404808 10:76085442-76085464 TTTCTCCTCCCAGCTGCTCCAGG - Intronic
1070934314 10:80281524-80281546 CACCTCCTCACAGCTGTGCTGGG + Intronic
1072307020 10:94117395-94117417 TGACTCCTACCAGCTCTGCTGGG + Intronic
1075429291 10:122366895-122366917 TAGGTCCTCCCATCTGTGCCTGG - Intergenic
1075809764 10:125216475-125216497 GAACTCCTTCCAGCTGAGCCTGG - Intergenic
1076729145 10:132429635-132429657 CGGCTCCTCCCGGCTGTGCCGGG + Intergenic
1077093238 11:788875-788897 TACCTCCTCCCACCTGTGCGTGG - Intronic
1077199301 11:1297434-1297456 TAACTGCTCGAAGCGGTGCCTGG - Intronic
1077327124 11:1968745-1968767 TGACCCCTCCCAGCCATGCCTGG + Intronic
1080937547 11:36880319-36880341 TTAATCCTCCCAGCTGTACCAGG + Intergenic
1081581471 11:44355192-44355214 TGAATCCTCCCAGCCCTGCCAGG - Intergenic
1081603712 11:44513427-44513449 TAACTCCCCTTAGGTGTGCCAGG - Intergenic
1082789102 11:57335309-57335331 TAGCAACTCCCAGCTGCGCCTGG + Intronic
1083060176 11:59861635-59861657 TAACTACTACCAGCTCAGCCTGG - Exonic
1083475223 11:62910899-62910921 TAACTACTTCCTGCTGAGCCTGG - Exonic
1083765593 11:64840052-64840074 CAACCCCTGCCAGCTGTGCTGGG - Intronic
1083839734 11:65297407-65297429 CAAGTCCTCCCTGCTGGGCCTGG - Exonic
1084992283 11:72938379-72938401 TAAGTTCTTCCAGCTATGCCAGG - Intronic
1085395266 11:76203855-76203877 TCCCTGCTCCCAGCTGTGCTGGG + Intronic
1086368719 11:86134792-86134814 TAAGTCCTTGCATCTGTGCCTGG - Intergenic
1089823684 11:121251858-121251880 GCACTGCTCCCAGCTTTGCCAGG - Intergenic
1202810106 11_KI270721v1_random:23925-23947 TGACCCCTCCCAGCCATGCCTGG + Intergenic
1092756459 12:11767986-11768008 TACTTCCTCCCAGCTGCTCCAGG + Intronic
1095905882 12:47377623-47377645 TCACTCCTCACAGCTACGCCAGG + Intergenic
1096792160 12:54052069-54052091 TACCTCCTCCCAGCCCAGCCTGG - Intronic
1097500460 12:60393968-60393990 TAACATCTCACAGCTGGGCCGGG - Intergenic
1098649166 12:72942080-72942102 TAAATGCTCGCAGCTCTGCCAGG + Intergenic
1100653743 12:96618399-96618421 TAACCCCTCCCACATGTGCTGGG - Intronic
1103225700 12:119285474-119285496 GGACTCCGCTCAGCTGTGCCTGG - Intergenic
1104691559 12:130829954-130829976 TCACACCTCCCTGCTCTGCCAGG + Intronic
1106119473 13:26847591-26847613 TAACTCCTGCAAGCTGTTCCTGG + Intergenic
1108573358 13:51771049-51771071 TAAGACCTCCCAGCCGGGCCTGG - Intronic
1113931345 13:113970563-113970585 TACCTCCAGCCAGCTGTGCTAGG - Intergenic
1114899419 14:27038046-27038068 TAAATAGTCCCAGGTGTGCCAGG - Intergenic
1117484487 14:56180771-56180793 TCATCCCTGCCAGCTGTGCCAGG + Intronic
1118087239 14:62431774-62431796 TGACTACTCCCAGCTTTGCCAGG + Intergenic
1118614742 14:67567668-67567690 TCTCTCCTCCCAGTTGTCCCAGG + Intronic
1119596658 14:75941199-75941221 AAACCCCTTGCAGCTGTGCCCGG + Intronic
1121029553 14:90646309-90646331 TATCCCCTCCCAGCTGTTCTGGG - Intronic
1121212207 14:92215795-92215817 TAACTGCTGCCAGGCGTGCCTGG + Intergenic
1121468986 14:94137409-94137431 TCCCTCCTCCCAGTTCTGCCAGG + Intergenic
1122207783 14:100156795-100156817 TCCCTCCTCCCTGCTCTGCCAGG - Intronic
1122267733 14:100554527-100554549 TCACTCCTCCCTGCTGCTCCAGG + Intronic
1202918138 14_KI270723v1_random:3561-3583 TCTCTCCTCCCGGCTGTCCCCGG + Intergenic
1124711260 15:32014246-32014268 TCACACTTCCCAGCTGTCCCAGG - Intergenic
1126195435 15:45925558-45925580 GCACTCTGCCCAGCTGTGCCAGG + Intergenic
1129258059 15:74345407-74345429 CACCTCCTCCCTGCTCTGCCTGG + Intronic
1129323582 15:74788009-74788031 GAGCTCCTACCAGCTCTGCCAGG - Intronic
1129494839 15:75969036-75969058 TAAGTCTTTCCAGCTGTTCCTGG - Intronic
1130807078 15:87334644-87334666 TAACTCCTCCTACTAGTGCCAGG - Intergenic
1132467788 16:85528-85550 TGGCCCCTCCAAGCTGTGCCAGG + Exonic
1133502297 16:6377871-6377893 TCCCTGCTCCCAGCTGAGCCGGG + Intronic
1134679551 16:16114696-16114718 CCACTCCTCCCTGCAGTGCCTGG + Intronic
1138090062 16:54166534-54166556 TGGCACCTCCCAGCTGTGCCAGG - Intergenic
1138928888 16:61628056-61628078 TTATACCTCCCAGCTGTGCATGG + Intergenic
1138980068 16:62257428-62257450 TAGCTCCTTCCAGCTTTGACAGG + Intergenic
1140455744 16:75104669-75104691 TAGCTGCCCCAAGCTGTGCCCGG - Intronic
1145191018 17:20842254-20842276 TGACTTCTCAGAGCTGTGCCTGG - Intronic
1147242360 17:39098909-39098931 TGACTGCACCCAGCTGTGCCCGG + Intronic
1148110829 17:45144012-45144034 TCACTCCTCCCAACTGGTCCGGG - Exonic
1148391195 17:47274447-47274469 GAGCTCCTGCCAGCAGTGCCTGG + Exonic
1148834648 17:50459652-50459674 CATCTCCTCCCAGCCCTGCCAGG - Intronic
1149561033 17:57608154-57608176 TAAATCCTGGCAGCTGTGCTGGG - Intronic
1150131242 17:62670410-62670432 TCAGTCCGCCCAGCTTTGCCGGG + Intronic
1151264312 17:72942270-72942292 TAACTCCTCTCAATTGGGCCAGG + Intronic
1152190677 17:78885571-78885593 TAAATCCTCCCCGAAGTGCCAGG - Intronic
1152201891 17:78952208-78952230 TAACAACTCCCAGCTGTGTGGGG - Intergenic
1152607254 17:81298224-81298246 TACCTCCTCCCAGCTGCTCTGGG + Intergenic
1152783122 17:82235215-82235237 TGACTCACCCCACCTGTGCCTGG - Exonic
1156001026 18:32384166-32384188 TGATTGCTCCCAGCTGTGGCTGG - Intronic
1156457335 18:37302184-37302206 TAACTCCATCCACCTGTGCCAGG - Intronic
1157586091 18:48802270-48802292 TAAGACCTACCACCTGTGCCCGG + Intronic
1160153018 18:76409642-76409664 TAACTCTTCACATCTGTGCTGGG + Intronic
1160169985 18:76544890-76544912 AAACTCCTCCCAGCTTTTCCAGG + Intergenic
1160284709 18:77530897-77530919 TCACTCTTCCCAGCCGTCCCAGG + Intergenic
1160550181 18:79689872-79689894 AAACTTATCCCAGCTGTGGCCGG + Intronic
1160995183 19:1879169-1879191 TGACTTCTCAGAGCTGTGCCTGG + Intronic
1161337104 19:3720599-3720621 AACCTGCGCCCAGCTGTGCCTGG - Intronic
1161739655 19:6012956-6012978 CAGCTCCTCCCAGCTCGGCCCGG + Intronic
1161769366 19:6223016-6223038 TAACACCTCACAGCTGGGCCTGG + Intronic
1163127878 19:15254098-15254120 AAACTCTTCCCACCTGTGCCTGG - Intronic
1163262851 19:16201686-16201708 GAAGTCCTCCCAGCTGGGCGCGG - Intronic
1164530630 19:29045743-29045765 AAACTGCTCCCAGCTGGGCCTGG - Intergenic
1164618187 19:29678947-29678969 ATCTTCCTCCCAGCTGTGCCTGG + Intergenic
1166794994 19:45420571-45420593 TCCCTCCTCCCACCTGTGGCAGG + Intronic
925569670 2:5295659-5295681 AAACTCTTCCCATCTCTGCCTGG + Intergenic
925655450 2:6142845-6142867 TAATTCATTCCAGCTTTGCCTGG + Intergenic
926128334 2:10285411-10285433 CAACTCCTCCCCTGTGTGCCTGG - Intergenic
926370427 2:12173168-12173190 GAAGTCCTCACTGCTGTGCCTGG + Intergenic
927463061 2:23316041-23316063 GAACTTCCCCCAGCTGTGCAGGG + Intergenic
932428065 2:71656218-71656240 TAACACCTTCAAGCTGTACCGGG + Exonic
934962646 2:98690405-98690427 TTCCTCCTTCCAGCTGTGCAGGG - Intronic
935216166 2:100976825-100976847 TGTCTCCTCCCAGCTGCGCAGGG + Intronic
939095442 2:137828320-137828342 AAAGTCTTCCCAGCTGTGCTAGG - Intergenic
943896502 2:193369302-193369324 TAATACCTCCCAGCTGTCACAGG - Intergenic
946724246 2:222646304-222646326 TATCTGCTCCCAGCTGTTCTGGG - Intronic
947653683 2:231808473-231808495 TAACTCCTCCTGGCTGCACCTGG + Exonic
948846303 2:240684268-240684290 TCAGTCTCCCCAGCTGTGCCAGG - Intergenic
948847560 2:240690462-240690484 TCAGTCTCCCCAGCTGTGCCAGG + Intergenic
949079319 2:242084215-242084237 GAACCCCTCTCAGCTGAGCCTGG - Intergenic
1168730795 20:79240-79262 GCACTTCTCCCAGCTGTGTCTGG - Intergenic
1169988107 20:11469530-11469552 TCACTCATCCCAACTGTGGCAGG + Intergenic
1171782102 20:29428221-29428243 TATCTCCTCCCGGCTGTCCCCGG + Intergenic
1172502067 20:35434481-35434503 GAACTCGGCCCAGCTGTGCCTGG - Exonic
1174399499 20:50268280-50268302 TTAATCCTCCCAGCAGTGCCAGG - Intergenic
1174707743 20:52674459-52674481 TCACTCCTCACAGCTGTACCAGG + Intergenic
1175284411 20:57828517-57828539 TCACCCCACCCAGCTCTGCCTGG + Intergenic
1175914838 20:62420988-62421010 TCACTCCGCCCAGCCCTGCCTGG - Intronic
1177922530 21:27170497-27170519 TATCTTCTCTCAGCTTTGCCTGG + Intergenic
1178499820 21:33116439-33116461 TAACTTCGCCCAGCTGTGGCTGG - Intergenic
1179504499 21:41831611-41831633 CAACTCCTCCCAGCTGGGAATGG + Intronic
1180792819 22:18586007-18586029 TCCCTTCTCCCACCTGTGCCTGG + Intergenic
1181228917 22:21409312-21409334 TCCCTTCTCCCACCTGTGCCTGG - Intergenic
1181249734 22:21525553-21525575 TCCCTTCTCCCACCTGTGCCTGG + Intergenic
1182419131 22:30240311-30240333 TAACTGCCCCCACCTATGCCAGG + Intergenic
1183751805 22:39725184-39725206 TAATTCCTCCCAGTTTTGCTGGG + Intergenic
1184470491 22:44692877-44692899 TAACACCACCCAGCTGTGCCTGG - Intronic
954277758 3:49553869-49553891 TCACACCTTCCATCTGTGCCCGG + Intergenic
954444219 3:50538055-50538077 TCAATCCTCCCATCTGTACCAGG - Intergenic
954934157 3:54311555-54311577 TTACTCCTGCCAGATGTGCAAGG - Intronic
955429852 3:58831606-58831628 TAACAAATCCCAGCTTTGCCTGG - Intronic
955954963 3:64279566-64279588 GAACTCTTTCCAGCTGGGCCTGG + Intronic
956598497 3:70994267-70994289 CAACTCCTCCCAGCTTGCCCAGG + Intronic
956616709 3:71179449-71179471 CATCTTCTTCCAGCTGTGCCAGG - Intronic
956744247 3:72298954-72298976 GGAGGCCTCCCAGCTGTGCCAGG - Intergenic
957083386 3:75658183-75658205 TCTCTCCTCCCGGCTGTCCCCGG - Intergenic
958695501 3:97522200-97522222 TAACACTTCCCAGCTGGGCATGG - Intronic
959951352 3:112184063-112184085 TAAGACCACCCAGCTGTCCCTGG - Intronic
961543996 3:127619287-127619309 TAGCACCTCCCGGCTCTGCCTGG - Intronic
961848914 3:129794981-129795003 AAACTCCTCCCAGCTGGGCTCGG + Intronic
963920141 3:150897521-150897543 TGCCTCTTCCCAGCTGTGCATGG + Intronic
969484052 4:7461879-7461901 CAGCACCTCCCAGGTGTGCCTGG - Intronic
969618219 4:8265812-8265834 TGACTCCACCCAGCCCTGCCAGG - Intergenic
969728203 4:8938354-8938376 ATGCCCCTCCCAGCTGTGCCTGG + Intergenic
970129025 4:12845948-12845970 GATCTCATCCCAGCAGTGCCCGG - Intergenic
970216737 4:13766862-13766884 AATCTGCTCCCAGCTCTGCCAGG + Intergenic
975707466 4:77125262-77125284 TAAATCTTCCCAGCTGGGCACGG - Intergenic
977263028 4:94820956-94820978 TAACTCTTACCAGCTGTGACAGG + Intronic
978265042 4:106813815-106813837 TTACTCATCCCAACTCTGCCTGG + Intergenic
979438717 4:120725820-120725842 TAAATCCACCCAGCTGTCACAGG + Intronic
983212075 4:164968981-164969003 TATCTCCTCCCAGCTGTTCTGGG - Intronic
983622334 4:169774529-169774551 CAACACCTCCCAGCTCGGCCTGG - Intergenic
983685722 4:170406258-170406280 TAACTGTTCCCAGCTGTCCATGG + Intergenic
984900755 4:184584392-184584414 TGATTCTTCCCAGCTGTGGCAGG + Intergenic
985775722 5:1840814-1840836 TCACTCCTCCCAGCTCCGGCAGG - Intergenic
987393484 5:17398788-17398810 TAACTCCACACAGCTGTGCCTGG + Intergenic
988795780 5:34652528-34652550 TAAATCCTCAGAGCTGTGCTGGG - Intergenic
991040876 5:62174374-62174396 TAAATACTCCCAGCTGGGCGCGG - Intergenic
991717516 5:69465478-69465500 TTACTGATCCCAGCTGTGTCAGG - Intergenic
992099724 5:73395544-73395566 TTTCTCCTTCCAGCTGTGGCAGG - Intergenic
995483627 5:112617014-112617036 TAATTTCACCCAGCTGTTCCTGG - Intergenic
995844919 5:116483239-116483261 TAAGTCCTTCCAGGGGTGCCAGG - Intronic
997564116 5:134874294-134874316 TAACACCTGGCAGCTGTGGCGGG - Exonic
998004817 5:138649837-138649859 TGACCCCTCCTAGCTGTCCCCGG - Intronic
1001043142 5:168351229-168351251 TAACTACTCCAACCTCTGCCAGG - Intronic
1003076729 6:2989035-2989057 TCCTTCCTCCCAGCTGCGCCCGG + Intronic
1003311147 6:4970960-4970982 TGACCCCTCCTCGCTGTGCCTGG - Intergenic
1004879886 6:19996799-19996821 TCTCTCCTCCCAGTTGTCCCAGG + Intergenic
1005583210 6:27252051-27252073 TAACTCCTCCCAGCTGTGCCAGG - Intronic
1005649458 6:27873378-27873400 TAACGCCTCCACGCCGTGCCAGG + Exonic
1006256372 6:32835673-32835695 TTTCTCCTCCCTGCTGCGCCAGG - Exonic
1006791434 6:36703752-36703774 TAACTCATCTCAGCTGCGTCAGG - Intronic
1016385738 6:143529304-143529326 TTCCTCCTCCTTGCTGTGCCAGG - Intergenic
1017274213 6:152547110-152547132 TTCCTTCTGCCAGCTGTGCCTGG - Intronic
1017911329 6:158795591-158795613 TAACTACTGCAAGGTGTGCCAGG + Intronic
1018726883 6:166619624-166619646 TGCCTCCTCCCAGCCTTGCCCGG + Intronic
1019731970 7:2633508-2633530 TCCCTCCTCCCTGCTGTGTCTGG - Intronic
1020048548 7:5063294-5063316 TAAGTCCTCCCATCTTTGCCTGG + Intronic
1021729854 7:23585733-23585755 CATGGCCTCCCAGCTGTGCCAGG - Intergenic
1022044244 7:26610668-26610690 TAGCACATCCCAGATGTGCCTGG - Intergenic
1023350363 7:39314353-39314375 CAACTCCTCCCAGCTAGGCATGG + Intronic
1023709191 7:42973971-42973993 AAATCTCTCCCAGCTGTGCCAGG + Intergenic
1024261823 7:47579243-47579265 TAACCCCTGCAAGCTGTGCCTGG - Intronic
1028833620 7:95350720-95350742 TAAATCCACCCAGTTTTGCCAGG + Intergenic
1031372865 7:120988662-120988684 TAGCTCCGCCCCGCTCTGCCCGG + Exonic
1033686654 7:143646736-143646758 TGACTGCTCCCAGCTGGCCCAGG - Intronic
1033689080 7:143720571-143720593 TGACTGCTCCCAGCTGGCCCAGG + Exonic
1033697955 7:143810878-143810900 TGACTGCTCCCAGCTGGCCCAGG + Intergenic
1035537472 8:403303-403325 GAACCCCTCTCAGCTGAGCCTGG - Intergenic
1036286994 8:7451617-7451639 TGTCTCCTCCAAGCTGTGACAGG - Intronic
1036334487 8:7859904-7859926 TGTCTCCTCCAAGCTGTGACAGG + Intronic
1038319449 8:26513998-26514020 TCCCTCCTCCCAGCGCTGCCGGG + Exonic
1040351799 8:46576394-46576416 TAACAACTGCCAGCTGTGTCAGG - Intergenic
1044264098 8:90162504-90162526 TCAGTCCTCTCAGCTGTGCTTGG - Intergenic
1045366504 8:101481301-101481323 TCAATCCTCCCACCTTTGCCTGG + Intergenic
1048415740 8:134225799-134225821 TGACTTTTCCCAGTTGTGCCTGG - Intergenic
1049305916 8:141903884-141903906 TCACTCCCCACAGATGTGCCTGG - Intergenic
1049521729 8:143094893-143094915 GAACTCCTCCCAGCCGGGACGGG - Intergenic
1055932829 9:81577091-81577113 TCACACCTGCCATCTGTGCCTGG + Intergenic
1056490056 9:87097332-87097354 TAATCCCTCCCTGCAGTGCCTGG + Intergenic
1057609211 9:96525723-96525745 TAATTCCTCCCAGCTGTGATGGG - Intronic
1058660370 9:107261040-107261062 TGGCTCCTAACAGCTGTGCCTGG + Intergenic
1061217709 9:129231429-129231451 CAACTACTCAGAGCTGTGCCGGG - Intergenic
1061261707 9:129483839-129483861 AAAATCTTCCCAGCTTTGCCAGG - Intergenic
1061498039 9:130986735-130986757 TAACTCCTCCCAGAGGAGTCCGG + Intergenic
1061895445 9:133644521-133644543 TCACTCCTCACAGCTTCGCCAGG + Intronic
1062060257 9:134491635-134491657 CCACTCCCCCCAGCTGTCCCAGG - Intergenic
1062236306 9:135510155-135510177 TAACTCCTCCTGGCCGGGCCTGG - Intergenic
1203745130 Un_GL000218v1:37169-37191 TAGCTCCTCAAAGCTGTTCCAGG - Intergenic
1203564980 Un_KI270744v1:82315-82337 TAGCTCCTCAAAGCTGTTCCAGG + Intergenic
1187032126 X:15498978-15499000 CCACTCCTCCCAGCTGTCCTTGG + Intronic
1187066414 X:15843266-15843288 CCACTGCACCCAGCTGTGCCTGG - Intronic
1187390608 X:18884288-18884310 GGGCTCCTCCCAGGTGTGCCAGG + Intergenic
1188968285 X:36581281-36581303 TGGCTCCTCCCAGCTGTTCCTGG + Intergenic
1190283399 X:48946288-48946310 AAACTCCTCACAGCTCTGTCCGG - Intronic
1192024313 X:67432321-67432343 TAACCCTTCTCAGCTATGCCAGG - Intergenic
1195037202 X:100981025-100981047 TCACCCCTCCCACCAGTGCCGGG - Intronic
1197373603 X:125655239-125655261 TAACTGCTGTCATCTGTGCCTGG + Intergenic
1199815871 X:151396658-151396680 TAACTCCTCCCAGCTGCCAAGGG + Intronic
1200037652 X:153343853-153343875 TGTCTTCTCCTAGCTGTGCCTGG + Intronic