ID: 1005583633

View in Genome Browser
Species Human (GRCh38)
Location 6:27255269-27255291
Sequence CTCCTTTGCCAGCTTGAGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005583633_1005583634 -10 Left 1005583633 6:27255269-27255291 CCTGGCTCAAGCTGGCAAAGGAG 0: 1
1: 0
2: 1
3: 14
4: 192
Right 1005583634 6:27255282-27255304 GGCAAAGGAGAGCCAGATTAAGG 0: 1
1: 0
2: 4
3: 20
4: 208
1005583633_1005583635 -9 Left 1005583633 6:27255269-27255291 CCTGGCTCAAGCTGGCAAAGGAG 0: 1
1: 0
2: 1
3: 14
4: 192
Right 1005583635 6:27255283-27255305 GCAAAGGAGAGCCAGATTAAGGG 0: 1
1: 0
2: 1
3: 18
4: 214
1005583633_1005583637 30 Left 1005583633 6:27255269-27255291 CCTGGCTCAAGCTGGCAAAGGAG 0: 1
1: 0
2: 1
3: 14
4: 192
Right 1005583637 6:27255322-27255344 TACCCTTTCCACTCCCTGCATGG 0: 1
1: 1
2: 2
3: 17
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005583633 Original CRISPR CTCCTTTGCCAGCTTGAGCC AGG (reversed) Exonic
901324786 1:8359896-8359918 CTTCTTGGCCAGCTTGGACCCGG + Exonic
902176683 1:14655830-14655852 CTTCTTTGGCCGCTTGAACCTGG - Intronic
904239303 1:29133831-29133853 CTACTCTGGCAGCATGAGCCAGG - Intergenic
904442469 1:30540660-30540682 CTCCTTTGCAACCTAGACCCTGG - Intergenic
908414990 1:63904452-63904474 TTCCTTTGCCAGCTTGTGTCTGG + Intronic
912889959 1:113519634-113519656 CTCCACTGGGAGCTTGAGCCTGG - Intronic
913211809 1:116588731-116588753 CTCCTCTGCCAGCTTGTACCAGG + Exonic
915455241 1:156036155-156036177 CTCTTCTGCCAGCTCGGGCCTGG + Exonic
916954681 1:169819866-169819888 TGCCTTTGCCAGATTGAACCCGG + Intronic
920056406 1:203195916-203195938 CTCCTTTGACAGCTTATTCCTGG - Intergenic
1065916986 10:30360734-30360756 ATCCTTTGCCACCTTGACCAGGG - Intronic
1070441113 10:76444283-76444305 CTCCTTTGCTGGGCTGAGCCTGG - Intronic
1072529823 10:96308463-96308485 ATCCTTCTCCAGCTTGACCCGGG - Intronic
1075390539 10:122087809-122087831 CTCCTTAGCCTGCTGGGGCCTGG - Exonic
1075870136 10:125766318-125766340 CTTCCTTGACAGCTTGACCCAGG + Intergenic
1077589340 11:3479589-3479611 CCCCTCTGCCAGGTTGAGCAGGG + Intergenic
1078219392 11:9338946-9338968 CTACTTGGGCAGCTTGAACCCGG - Intergenic
1080168427 11:29269222-29269244 CTTCTTTGCTAGATTGAGGCTGG - Intergenic
1080768646 11:35320396-35320418 CTCCTTTGCAAGCTTGCTCATGG - Intronic
1081249880 11:40816082-40816104 CTCCTTTACCAGGTGGACCCAGG - Intronic
1082997917 11:59267533-59267555 AACCTTTGCCAGCTGGGGCCAGG + Intergenic
1083160291 11:60850219-60850241 CTTCTTTGCCCGCTTGAGCTTGG - Exonic
1083737708 11:64691109-64691131 CTTCTTTGCCAGTTAGACCCTGG + Intronic
1084261461 11:67981507-67981529 TCCTTTTGCCAGGTTGAGCCGGG + Intergenic
1084307863 11:68298547-68298569 CTTCTTTGCCAGCTTTGGCGAGG + Intergenic
1084629830 11:70340832-70340854 CAGCCTTGCCAGATTGAGCCGGG - Intronic
1084630434 11:70344929-70344951 CAGCCTTGCCAGATTGAGCCGGG - Intronic
1087138029 11:94740102-94740124 TTACTTTGCCCACTTGAGCCAGG + Intronic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1089942218 11:122430662-122430684 CTCTTGGGCCTGCTTGAGCCAGG - Intergenic
1091073317 11:132589694-132589716 CTCCTTTGTAAGCTTAACCCAGG + Intronic
1093497993 12:19779599-19779621 CTGCTCTGCTAGCCTGAGCCGGG + Intergenic
1093516657 12:19994951-19994973 CTCCTTTCCCATGTTGAGCGTGG - Intergenic
1093747525 12:22760040-22760062 CTGCTTTGCCAGGTTGAGAACGG - Intergenic
1096834608 12:54341640-54341662 CCCCTTTGCCAGGGAGAGCCTGG + Intronic
1097676355 12:62606311-62606333 CTCCTTTGTCAGCTTCACCATGG - Intergenic
1097720275 12:63012343-63012365 CTTCTTTGGCCTCTTGAGCCTGG + Intergenic
1101796738 12:107982088-107982110 CCCCTTTGCCACCTTCATCCAGG + Intergenic
1102989322 12:117303505-117303527 CACCTTTACCAGCTAGAGGCTGG + Intronic
1103722510 12:122982274-122982296 CTGCCTTGCCAGCCTCAGCCCGG - Intronic
1104719966 12:131039741-131039763 GCCCTTTCCCAGCGTGAGCCTGG - Intronic
1105201039 13:18178379-18178401 GTCTTTTTCCAGCCTGAGCCAGG + Intergenic
1105215065 13:18279357-18279379 CTCCTCTGCCAGCTTGTACCAGG + Intergenic
1106524339 13:30527013-30527035 CTCCTTGGCCAGGAGGAGCCCGG + Intronic
1107575712 13:41719590-41719612 CTCCTTTGCCAGCTGCACACTGG + Exonic
1113692647 13:112322607-112322629 TTCCTATGCCAGCTTGAACTGGG - Intergenic
1114573897 14:23695308-23695330 CTCTTTTTCCAGATAGAGCCGGG - Intergenic
1117038443 14:51749610-51749632 CCCTTCTGCCAGGTTGAGCCGGG - Intergenic
1117611237 14:57485327-57485349 CTCCTTGGCCAGCTTATTCCTGG - Intronic
1118199885 14:63662355-63662377 CTCCTTTGGCCTCTTGAACCTGG - Intergenic
1118470696 14:66072731-66072753 CGCCTTTGTCAACTTCAGCCAGG + Intergenic
1122519552 14:102333867-102333889 CTGGGTTCCCAGCTTGAGCCTGG - Intronic
1122602387 14:102928261-102928283 TTCCTCTGCCAGCCTCAGCCAGG + Intronic
1122804011 14:104247649-104247671 CTCCCTGGGCAGCCTGAGCCGGG + Intergenic
1124505094 15:30265452-30265474 CTCCAGTACCAGCCTGAGCCTGG + Intergenic
1124738458 15:32273183-32273205 CTCCAGTACCAGCCTGAGCCTGG - Intergenic
1127007042 15:54582231-54582253 CTCCTTTGCTTGCTTGACCCTGG - Intronic
1131425662 15:92343737-92343759 CTCATTTGCCAGCTTGTCCAAGG + Intergenic
1131660065 15:94504995-94505017 CTCCTCTGCCAGGATTAGCCTGG + Intergenic
1133193313 16:4150577-4150599 CTCCTTTGGGAGGTTGAGGCAGG - Intergenic
1133316835 16:4890138-4890160 CTCCCTTGCCAGTGTGTGCCTGG + Intronic
1135967562 16:27048705-27048727 CTCCTTTCCCTGCTTTATCCCGG + Intergenic
1138459121 16:57137725-57137747 CTACTTTGGCAGCCTCAGCCGGG - Intronic
1139324111 16:66138670-66138692 CACCTTCCCCAGGTTGAGCCAGG - Intergenic
1146489850 17:33272968-33272990 CTCCTTTTCCACCTGGAGACAGG + Intronic
1147816345 17:43213375-43213397 CTCCCTGGCCAGCCTGAGACTGG - Intronic
1148967167 17:51445995-51446017 CTTCTTTGGCCTCTTGAGCCTGG - Intergenic
1150200066 17:63345872-63345894 CTCATGAGCCAGCTTGAGTCAGG + Intronic
1151882407 17:76903446-76903468 GGCCTCTGCCAGCTTGTGCCTGG - Intronic
1153667283 18:7377339-7377361 CTCCTTTGCCAGCTGGAATGTGG - Intergenic
1153735756 18:8065378-8065400 TTTTTCTGCCAGCTTGAGCCAGG - Intronic
1155074430 18:22342290-22342312 CTCCTTGGCAAGGTCGAGCCAGG - Intergenic
1155948215 18:31879576-31879598 TTCTTTTGCCAGCTTGGGCTTGG - Intronic
1157563487 18:48664354-48664376 CTGCTCTGCCAGGTTCAGCCTGG + Intronic
1160805299 19:989936-989958 CTCCTCTCCCCGCCTGAGCCCGG - Intronic
1162100126 19:8334282-8334304 CTCCTGTGGCAGCTTCTGCCGGG - Intronic
1162110715 19:8398219-8398241 CTCCTTGGCCAGCATGAGACAGG + Intronic
1164534616 19:29075981-29076003 CTCCGTGGCAAGCTTGTGCCTGG + Intergenic
1165211087 19:34236389-34236411 CCCCGTTGCAAGTTTGAGCCTGG - Intergenic
1166181821 19:41114178-41114200 TTGCTTTGCCAGTTGGAGCCTGG - Intergenic
1166747365 19:45147692-45147714 CCCCTTTGCCAGCAGGGGCCTGG + Intronic
1167521033 19:49955261-49955283 CTCTTTTTCCAGATAGAGCCAGG - Intronic
1167994798 19:53393753-53393775 CTCCATTACCAACTAGAGCCAGG + Intronic
1168048519 19:53811164-53811186 CTCCTTCACCAGCAGGAGCCGGG + Exonic
925259456 2:2517201-2517223 CCACTGTGCCAGCTGGAGCCAGG + Intergenic
925985283 2:9210217-9210239 CTCCTTTGTCAGATTGACCTGGG + Intronic
926250373 2:11152517-11152539 CTCCTTGGCCAGCTTCAGTCAGG + Intergenic
928784344 2:34864225-34864247 CTGCTCTGCCAGGTGGAGCCAGG - Intergenic
929411639 2:41703416-41703438 CTTCTTTGCCCACTTGAACCTGG - Intergenic
929870465 2:45754860-45754882 ATCCTTAGCCAGCTTGATGCTGG - Intronic
931670151 2:64640420-64640442 GACCTTGGCCAGCCTGAGCCAGG - Intronic
931720975 2:65067678-65067700 TTCCTTTGCCAAAATGAGCCAGG - Intronic
932754410 2:74396456-74396478 CTACTTTTCCAGGCTGAGCCTGG - Intergenic
934066730 2:88348426-88348448 CTCCTTCCCCTGCTTTAGCCAGG + Intergenic
934299255 2:91767380-91767402 CTCCTCTGCCAGCTTGTACCAGG - Intergenic
934626175 2:95856094-95856116 GTCTTTTTCCAGCCTGAGCCTGG + Exonic
934807392 2:97245221-97245243 GTCTTTTTCCAGCCTGAGCCTGG - Exonic
934830118 2:97511966-97511988 GTCTTTTTCCAGCCTGAGCCTGG + Exonic
941661939 2:168204094-168204116 CTACTTTGCCAGCTAGCACCTGG - Intronic
942157760 2:173148919-173148941 CTGCTCTCCCAGATTGAGCCAGG + Intronic
942264696 2:174210984-174211006 ATCCTCTGCCAGGTAGAGCCAGG - Intronic
942457279 2:176147146-176147168 CTCCCTTTCCAGCTTCAGCTTGG - Intergenic
947594642 2:231403325-231403347 CTCTTCTGCCAGGTTGAGCAGGG - Intergenic
947800819 2:232927824-232927846 CCTCTTTCCCAGCTTGCGCCCGG - Intronic
948545813 2:238727961-238727983 CTCCTTTGGAAGCATGAGGCTGG + Intergenic
1168892055 20:1300983-1301005 GTCCTTTCCCAGCTTCAGCCTGG + Intronic
1170865587 20:20152787-20152809 CTCCATTGACAGCCTGAGACAGG + Intronic
1172280408 20:33703809-33703831 CTCCTTTGCCAGCCTCTGGCAGG - Exonic
1172631016 20:36378157-36378179 CTCCTCTGCCAGGTTGAGTAGGG - Intronic
1174159686 20:48541989-48542011 CTCCACTGCGAGCCTGAGCCTGG - Intergenic
1174270645 20:49365872-49365894 CTCCTGTGCCCTCATGAGCCTGG - Exonic
1175089612 20:56491240-56491262 TTCTTATTCCAGCTTGAGCCTGG + Intronic
1175130911 20:56788902-56788924 CTTTCTTGCCAGCTTGAACCTGG - Intergenic
1175621080 20:60448165-60448187 CTTTTTCTCCAGCTTGAGCCTGG + Intergenic
1177196752 21:17911459-17911481 CTCCCTTCCCAGGTGGAGCCTGG + Intronic
1178752496 21:35318015-35318037 CACCTATGCCAGCTAGAGGCAGG + Intronic
1179438002 21:41375197-41375219 CTCCCTTGTCACCTGGAGCCTGG + Intronic
1183315463 22:37134739-37134761 CTCCTCTGCCATCCTGATCCCGG + Intronic
1183564580 22:38604394-38604416 CTCCCTTGCTAGCTGGTGCCTGG + Intronic
1183597579 22:38821937-38821959 TTCCTTTCCCAGCTCCAGCCTGG - Exonic
1184710157 22:46245027-46245049 CTCCTGGGCCAGCCTGCGCCAGG - Exonic
949882693 3:8674380-8674402 CCCTTCTGCCAGGTTGAGCCGGG - Intronic
951679838 3:25283254-25283276 CACTTTTGCCAGCCTGAACCAGG + Intronic
953356845 3:42263517-42263539 CTCCTCTGCCCGCTGCAGCCCGG + Exonic
954369686 3:50163685-50163707 CTCCTTGGCCAGCCAGAGCAAGG + Intronic
954732846 3:52679605-52679627 CTCCTTTTCCTGCTTGGGCCTGG + Exonic
954904227 3:54046030-54046052 GTCCTTTGCAAGCCTGTGCCTGG - Intergenic
956576405 3:70757286-70757308 ATCCTTTGCCTCCTTGCGCCTGG - Intergenic
956696168 3:71921123-71921145 GTCCTTTGCCAGCCAGAGCTTGG + Intergenic
958185933 3:90118817-90118839 CTCCATTCCCAGCTTGAGCCAGG - Intergenic
959869499 3:111310370-111310392 CTCATTTTCCAGCTGCAGCCTGG - Intronic
962992697 3:140593409-140593431 CTTCTCTGCCAAGTTGAGCCAGG + Intergenic
963732147 3:148985038-148985060 CTCTTCTGCCAGCTTGGGCCTGG + Intergenic
963904631 3:150763267-150763289 CTGCGCTGCCAGCTGGAGCCGGG - Exonic
965845041 3:172951678-172951700 CACCTCTGCCAGCTTGTGCTGGG + Intronic
969019988 4:4133374-4133396 CCCTTCTGCCAGGTTGAGCCGGG + Intergenic
969025601 4:4169724-4169746 CCCTTCTGCCAGGTTGAGCCGGG + Intergenic
972584541 4:40425189-40425211 CTCCTTTGCCACCGTTAGCCGGG - Exonic
977397286 4:96486515-96486537 CTCCTTTACCTGCATGAGCATGG + Intergenic
980847521 4:138341945-138341967 CTCTTTTACCAGCTTGTGGCAGG - Intergenic
982086422 4:151841173-151841195 CTCCTTCTCCAGCTCCAGCCTGG + Intergenic
990107454 5:52281668-52281690 CCTCTTTGCCATCTTGAGCATGG + Intergenic
991931332 5:71755781-71755803 CTCCATTGCACACTTGAGCCAGG - Intergenic
995337397 5:111015663-111015685 CTCCTTTGCTGGCTTGCTCCTGG - Intergenic
996646515 5:125824707-125824729 CTCATTTGTCAGCTGGACCCAGG - Intergenic
998910312 5:146952631-146952653 CTGTTTTGCTAGCTTTAGCCAGG + Intronic
999444530 5:151628574-151628596 GTCCTGTGCCAGCTTGTTCCCGG - Intergenic
1001015693 5:168139057-168139079 CTCCTTGGGAAGCTTGAGCAAGG - Intronic
1001281032 5:170386600-170386622 CTCCTTTCCCTGCCTGTGCCCGG - Intronic
1001311694 5:170615595-170615617 GCCCTTTGCCAGCTTTAACCTGG - Intronic
1002098055 5:176843749-176843771 CTCCTTGGCCAGCCTGAGCAGGG - Intronic
1002201486 5:177531282-177531304 CTTCTTTTTCAGCTTGTGCCGGG + Intronic
1003407051 6:5834334-5834356 CTCCTCTGCCACCTGGGGCCGGG + Intergenic
1003875068 6:10428211-10428233 CTCTTTGGGCAGTTTGAGCCAGG - Intergenic
1005039592 6:21588876-21588898 ATCCTTGGCGAGCTTAAGCCAGG + Intergenic
1005583633 6:27255269-27255291 CTCCTTTGCCAGCTTGAGCCAGG - Exonic
1007833591 6:44657230-44657252 CTCCTATGCCAGGTGCAGCCAGG + Intergenic
1007938014 6:45751084-45751106 CCCCTTAGCTAGCTTCAGCCAGG - Intergenic
1012491750 6:99789693-99789715 ATCCTTTGCCACTTTGAGGCAGG - Intergenic
1014645362 6:123966175-123966197 CTCTTTTGTCAGCTGGATCCAGG + Intronic
1015061403 6:128971099-128971121 CTCCTTTGCCTTCCTGTGCCTGG + Intronic
1017910359 6:158787108-158787130 CTTCTTATCCAGCTTCAGCCAGG + Exonic
1019699783 7:2469031-2469053 CTCCTTTACCAGCATGGGGCAGG - Intergenic
1020307394 7:6845409-6845431 CCCTTCTGCCAGGTTGAGCCGGG + Intergenic
1020308881 7:6854807-6854829 TGCCTTTGCCAGCCTCAGCCAGG - Intergenic
1020350678 7:7215376-7215398 TCCCTTTGCCAGTTTGTGCCGGG + Intronic
1021286576 7:18788150-18788172 CTTCTCTGCCAGCTGGAGCTTGG + Intronic
1021691011 7:23230725-23230747 CTCCTCTGCCACCTTGGCCCAGG + Intergenic
1021984586 7:26086267-26086289 CTTCTTTGGCCTCTTGAGCCTGG + Intergenic
1022140808 7:27491766-27491788 CTGCTTTGCCCGCTTGAGCTTGG + Intergenic
1027463595 7:78486519-78486541 CTCATCTGCCATCTTGGGCCAGG - Intronic
1029078522 7:97954348-97954370 CCCTTCTGCCAGGTTGAGCCGGG + Intergenic
1030037445 7:105419990-105420012 CTCCATTTCCAACCTGAGCCGGG + Intergenic
1031823221 7:126530483-126530505 CTCCTTTGCAAGGCTGAGTCTGG - Intronic
1034496062 7:151423319-151423341 CTCCGTGGCCAGCTGGAACCAGG - Intergenic
1043034282 8:75177569-75177591 CCCCATTGCCAGCCTGAGGCAGG + Intergenic
1050079212 9:1897698-1897720 CTCCATTGCCAGCTGGATTCTGG - Intergenic
1052817317 9:33111744-33111766 CGCCTTTGCCAGGTCCAGCCTGG - Exonic
1053588987 9:39491286-39491308 TTCCTCTTCCAGCTTGAGGCTGG - Intergenic
1054577315 9:66874009-66874031 TTCCTCTTCCAGCTTGAGGCTGG + Intronic
1055470479 9:76605557-76605579 CTCGTTTGCTAGTTTAAGCCAGG - Intergenic
1056193217 9:84205288-84205310 CTTCTTTGGCATCTTGATCCCGG - Intergenic
1057129437 9:92642715-92642737 CTCCTTTGCCCCCTTGTGTCAGG - Intronic
1058944789 9:109846233-109846255 CTTCTTTCCCAGCCTGAGCTTGG - Intronic
1059923817 9:119186500-119186522 CTGCTCTGCCAGCTTGGGCATGG - Intronic
1060051804 9:120383393-120383415 CTCCAGTGGCAGCTTGAGGCGGG - Intergenic
1060771956 9:126338264-126338286 CTCCTTTGTCTGCCTCAGCCGGG + Intronic
1061029099 9:128068759-128068781 CTTCTTTGGGTGCTTGAGCCGGG + Intronic
1061062084 9:128255498-128255520 CTCCCTCGCCTGCCTGAGCCTGG - Intergenic
1061425620 9:130496657-130496679 CTCCTTGGCCACCTTCTGCCTGG - Intronic
1062591799 9:137277772-137277794 CTCCTGGGCCAGCTTCGGCCTGG - Exonic
1203583319 Un_KI270746v1:35557-35579 GTCTTTTTCCAGCCTGAGCCAGG - Intergenic
1186099816 X:6144197-6144219 CTCCTTAGCATGCTTGAGCAAGG + Intronic
1186596937 X:10992192-10992214 ATCCTTTTCCAGTTAGAGCCAGG - Intergenic
1187697635 X:21937779-21937801 CTTCTTTGGCCGCTTGAACCTGG + Intergenic
1189158992 X:38791194-38791216 CTCCTTTGCCAGCCAGCCCCTGG - Intergenic
1191110304 X:56799080-56799102 TTCCTCTCCCAGCTTCAGCCTGG - Intergenic
1192363165 X:70451993-70452015 CTCCTCAGCCAGCATGTGCCTGG - Exonic
1194426033 X:93739379-93739401 CTCATTTGCCAGCTTTTCCCAGG - Intergenic
1196298919 X:114031905-114031927 CTCCTTTCCCACCCTGATCCTGG - Intergenic
1196685697 X:118508708-118508730 CTCCCTTGCTAACTTGACCCTGG + Intronic
1196892725 X:120306543-120306565 CTCTTTTGCCAGTTTGGGGCAGG - Intronic
1197744333 X:129920895-129920917 CTCCTTTTCCACCTTGTTCCTGG - Intronic
1197838386 X:130719411-130719433 CACGTTTCCCAGCTTGAGGCTGG + Intronic
1202270038 Y:23062535-23062557 CTTCTTTGACATCTTGAACCTGG + Intergenic
1202295989 Y:23358147-23358169 CTTCTTTGACATCTTGAACCTGG - Intergenic
1202423032 Y:24696280-24696302 CTTCTTTGACATCTTGAACCTGG + Intergenic
1202447757 Y:24973806-24973828 CTTCTTTGACATCTTGAACCTGG - Intergenic