ID: 1005583878

View in Genome Browser
Species Human (GRCh38)
Location 6:27257743-27257765
Sequence TTGAATATACAAATGGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005583878_1005583884 15 Left 1005583878 6:27257743-27257765 CCATTATCCATTTGTATATTCAA No data
Right 1005583884 6:27257781-27257803 TGTTGGATCTCATGTGGCTTGGG No data
1005583878_1005583885 16 Left 1005583878 6:27257743-27257765 CCATTATCCATTTGTATATTCAA No data
Right 1005583885 6:27257782-27257804 GTTGGATCTCATGTGGCTTGGGG No data
1005583878_1005583883 14 Left 1005583878 6:27257743-27257765 CCATTATCCATTTGTATATTCAA No data
Right 1005583883 6:27257780-27257802 CTGTTGGATCTCATGTGGCTTGG No data
1005583878_1005583882 9 Left 1005583878 6:27257743-27257765 CCATTATCCATTTGTATATTCAA No data
Right 1005583882 6:27257775-27257797 TTTGTCTGTTGGATCTCATGTGG No data
1005583878_1005583880 -2 Left 1005583878 6:27257743-27257765 CCATTATCCATTTGTATATTCAA No data
Right 1005583880 6:27257764-27257786 AATTCTCAACCTTTGTCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005583878 Original CRISPR TTGAATATACAAATGGATAA TGG (reversed) Intergenic
No off target data available for this crispr