ID: 1005592718

View in Genome Browser
Species Human (GRCh38)
Location 6:27345449-27345471
Sequence CAGTATCCATAGCTGGAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005592714_1005592718 2 Left 1005592714 6:27345424-27345446 CCAGAATAAATTATGCATGAAGG No data
Right 1005592718 6:27345449-27345471 CAGTATCCATAGCTGGAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005592718 Original CRISPR CAGTATCCATAGCTGGAGTT TGG Intergenic
No off target data available for this crispr