ID: 1005601158

View in Genome Browser
Species Human (GRCh38)
Location 6:27427635-27427657
Sequence ATGTGGGTCTTGAGCTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005601158_1005601165 26 Left 1005601158 6:27427635-27427657 CCTCCTGAGCTCAAGACCCACAT No data
Right 1005601165 6:27427684-27427706 GATCCATATCAGCATTCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005601158 Original CRISPR ATGTGGGTCTTGAGCTCAGG AGG (reversed) Intergenic
No off target data available for this crispr