ID: 1005605341

View in Genome Browser
Species Human (GRCh38)
Location 6:27472168-27472190
Sequence AGGAAGGAACGGTATGCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005605341 Original CRISPR AGGAAGGAACGGTATGCTTA GGG (reversed) Intronic
900108903 1:997579-997601 AGGAAGGGACGGTCTTCTTGGGG - Intergenic
904111402 1:28129179-28129201 AGGAAGGAAAGGTGTGCTATGGG - Intergenic
906054049 1:42900403-42900425 AGGCAGGAATGGCCTGCTTAGGG + Intergenic
913210102 1:116575352-116575374 AGGAGGGTACGGTATACTTGGGG + Exonic
915900750 1:159845060-159845082 AGGAAAGAAGGGTTTGCTTCTGG + Intronic
918158263 1:181872275-181872297 AGGAAGGAATGGCCTGCTTGGGG - Intergenic
918402337 1:184175997-184176019 AGGAAGGGACTTTATGCATATGG - Intergenic
919641368 1:200048126-200048148 AGGAAGGAAAGGTATAAATAAGG - Intronic
920678792 1:208057403-208057425 AGGAAGGGACAGTATGGATATGG + Intronic
923949055 1:238926512-238926534 AGGAAGGAAATGCATGCTCAGGG + Intergenic
924827111 1:247551210-247551232 AGGAAGGAAGGACATGCTTGAGG + Intronic
1064803271 10:19100257-19100279 AGGAAGGAACATTTTTCTTAGGG - Intronic
1071518054 10:86312324-86312346 AGAAAGGGACGGTGTGTTTAGGG - Intronic
1075541397 10:123317250-123317272 AAGAAGGAACCGTGTGCTTCTGG - Intergenic
1079080620 11:17411164-17411186 AGGAAGGAAGGGTAGGCGTGGGG - Intronic
1083045296 11:59729134-59729156 AGGAAGGAAGGGGATGGTGATGG - Intronic
1083458662 11:62796474-62796496 AGGAATGAAAGGAATGCTCAGGG + Exonic
1084569976 11:69953509-69953531 AGGAATGAACGCTGTGCTGAGGG + Intergenic
1086676353 11:89611791-89611813 AGGGAGGGAAGGTATGCATAGGG - Intergenic
1091367826 11:135037149-135037171 AGGAAGGAACAGGGTGCTGAAGG + Intergenic
1093297825 12:17412876-17412898 ATGAAGGATCATTATGCTTATGG + Intergenic
1094030964 12:26010707-26010729 AGGAGGGAAAGGAATGCTTCTGG + Intronic
1094599570 12:31896686-31896708 AGGAAGGAAGGGTAGAGTTAGGG + Intergenic
1095115091 12:38343803-38343825 AGGAAGGAATGGCCTGCTTGGGG - Intergenic
1095285058 12:40400973-40400995 AGGAAGTAAGGGTACGCTTGGGG + Intronic
1095922760 12:47547024-47547046 AGGAAGAAAAGGTATGTTAAAGG + Intergenic
1107890366 13:44909114-44909136 TGAAAGGAAAGGCATGCTTATGG + Intergenic
1108072017 13:46637590-46637612 AGGAAGGCACGGGATCCTTAAGG - Intronic
1113329864 13:109317473-109317495 AGGCAGGAATGGTCTGCTTGGGG - Intergenic
1115172346 14:30523955-30523977 AGGAAGGAAAGGTAAGGTAATGG - Intergenic
1120835782 14:89037387-89037409 AGGAATGAAGGGTCTGCGTAAGG + Intergenic
1121420713 14:93811505-93811527 AGGGAGGAAAGGGAGGCTTAGGG - Intergenic
1125270673 15:37935429-37935451 AGGAAGGTATGGCATGCTTGGGG - Intronic
1129546706 15:76403466-76403488 AGGAAGGATAGGTGGGCTTAGGG + Intronic
1132712123 16:1273594-1273616 AGGAAGGAACTGGATTCTTGGGG + Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1138798070 16:59993655-59993677 AGGAAGGAATGGCCTGCTTGGGG + Intergenic
1138984093 16:62305754-62305776 AGGTAGGAAGGATTTGCTTAAGG - Intergenic
1141041129 16:80673642-80673664 GGGAAGAAAGGGTATGCATATGG - Intronic
1144206875 17:12985619-12985641 TGGAAGGAACGGGATGTTTTTGG + Intronic
1144502689 17:15803115-15803137 GGGAAGGAAGAGTAGGCTTAGGG + Intergenic
1145164868 17:20605769-20605791 GGGAAGGAAGAGTAGGCTTAGGG + Intergenic
1146470146 17:33117631-33117653 AGGAAGGGACAGTAGGCTAAAGG + Intronic
1147162377 17:38575711-38575733 AGGAAAGAAAGGTATGCTGTGGG - Intronic
1147507698 17:41035971-41035993 AGGAAGGAAGGGAGAGCTTAGGG + Intergenic
1149585597 17:57784085-57784107 AGGGAGGAAAGTTATGTTTAGGG + Intergenic
1149881408 17:60295828-60295850 AGGAAGAAACGGTATATATAGGG + Intronic
1155868693 18:30998374-30998396 AGGGAGGAAAGATGTGCTTATGG + Intronic
1158272761 18:55734310-55734332 AGGAAGGGACAGGATACTTACGG + Intergenic
1158280136 18:55815820-55815842 AGGAAGGTAAGGTGTGCTTTTGG + Intergenic
1165281470 19:34801894-34801916 AGGAAGAAACTGTATACTTAGGG - Intergenic
1167411261 19:49345269-49345291 AGGAAGGAAAGGCCTGCTGAGGG - Intronic
1168726349 19:58584431-58584453 AGGAATAAACGGTGTGCTGAAGG + Intergenic
928194896 2:29208483-29208505 AGGAAGGAACGCTGAGCTTGTGG + Intronic
928733652 2:34261250-34261272 AGGCAGGAATGGCCTGCTTAGGG - Intergenic
932134922 2:69219890-69219912 AGGAAGGATGGAGATGCTTATGG - Intronic
936918120 2:117660910-117660932 GGGAAGGTAAGGCATGCTTAAGG + Intergenic
940615936 2:156048288-156048310 AGGAGGGAACCGTATGAATAGGG + Intergenic
944044410 2:195392261-195392283 AGGAGGGAATGGAATGCTGATGG - Intergenic
946461721 2:219874786-219874808 AGGAAGAAACTGTATTTTTATGG + Intergenic
947837130 2:233183788-233183810 AGGAAGGAAAGGTTTGTTCATGG + Intronic
1169295393 20:4392907-4392929 AGAAAGGAACAATATGTTTAAGG - Intergenic
1169336295 20:4759948-4759970 AGGCAGGAATGGGATGCTTGGGG + Intergenic
1174841486 20:53905384-53905406 AGGCAGGAACGATCTGCGTAGGG - Intergenic
1176402065 21:6322842-6322864 AGAAAGGAAAGGTATGCCTTTGG - Intergenic
1176435092 21:6666262-6666284 AGAAAGGAAAGGTATGCCTTTGG + Intergenic
1176459354 21:6993332-6993354 AGAAAGGAAAGGTATGCCTTTGG + Intergenic
1176880358 21:14184892-14184914 AGTAAGTAAGGGTATGCATAAGG + Intronic
1177174525 21:17689652-17689674 AGGCAGGAACTGGCTGCTTAGGG + Intergenic
1178208485 21:30499182-30499204 TGGAAGGAAATGTATTCTTAAGG + Intergenic
1178782806 21:35621539-35621561 AGGCAGGAACTGTCTGCTTCAGG - Intronic
1179087869 21:38236480-38236502 AGGAAGAAACGGCATGTTTATGG - Intronic
1179237021 21:39556601-39556623 ATGAAGCAACGGTATGGTTTAGG - Intronic
1179399511 21:41070819-41070841 AGGAAGAGACGGTATGATGAGGG + Intergenic
1182522466 22:30892160-30892182 GGGCAGGAAGGGTTTGCTTAGGG + Intronic
1182763922 22:32744943-32744965 AGGAAGGAAAGCAATGTTTACGG + Intronic
956795982 3:72719229-72719251 AGGAAGGAAGGGTAAGGGTAGGG + Intergenic
957016491 3:75069931-75069953 AGGCAGGAATGGCATGCTTAGGG + Intergenic
959037431 3:101383722-101383744 AGGAGGGAAGGGGATGCTGAGGG + Intronic
959964226 3:112335378-112335400 AGGAAGGGATAGCATGCTTATGG + Intronic
960901737 3:122560974-122560996 TGGAAGAAATGGAATGCTTAGGG - Intronic
964839778 3:160981052-160981074 AGGAAGGAAGAGGAGGCTTATGG - Intronic
965206569 3:165725656-165725678 TGGAAGTAACAGTGTGCTTATGG - Intergenic
968482047 4:837607-837629 AGGAAGGAGCAGCATGCTCAGGG - Intergenic
969380860 4:6796749-6796771 AGGAAGGTAAGATATTCTTATGG - Intronic
971468351 4:26989969-26989991 AAAAAGGAAAGATATGCTTATGG + Intronic
971540221 4:27806989-27807011 AGGAGGGAGAGTTATGCTTAGGG + Intergenic
974624945 4:64413575-64413597 GGGAATGAATGGTAAGCTTATGG + Intergenic
975663957 4:76715562-76715584 AGGAAGGAATGAGAAGCTTATGG - Intronic
976985632 4:91292961-91292983 CTGAAGGAACCGTATACTTAAGG - Intronic
984323478 4:178223924-178223946 AGGCAGGAATGGTCTGCTTAGGG - Intergenic
988537742 5:32084077-32084099 AAGCAGGAACATTATGCTTAAGG + Intronic
989623122 5:43403893-43403915 TGGAAGGAAGGGTATGGTGATGG + Intronic
990833135 5:59983155-59983177 ATGAAGCAACAGCATGCTTATGG - Intronic
993250381 5:85513511-85513533 AGGCAGGAATGGGCTGCTTAGGG + Intergenic
993508646 5:88744063-88744085 AGAAAGGACCAGTATGCTCAAGG - Intronic
999514910 5:152291399-152291421 ATGAGGGAACGGCATGCTGATGG - Intergenic
1001434321 5:171687401-171687423 AGGAAGGAGCTGTGTGCTTGAGG - Intergenic
1003110262 6:3247336-3247358 AGGAATGCATGGGATGCTTATGG - Intronic
1005132114 6:22521337-22521359 TGGAAGGGACAGTCTGCTTAAGG + Intergenic
1005605341 6:27472168-27472190 AGGAAGGAACGGTATGCTTAGGG - Intronic
1008387094 6:50904131-50904153 AGGCAGTAAAGGTATGGTTAAGG + Intergenic
1008848688 6:55997738-55997760 AGAAAGAATCTGTATGCTTAGGG - Intergenic
1012570728 6:100724621-100724643 TGGAATGAAGGGTATGCTTGTGG + Intronic
1012806704 6:103903753-103903775 AGGAAGGAATGGGCTGCCTAGGG + Intergenic
1013044445 6:106470346-106470368 ATGAAGGAATGGTAGGCTGAGGG - Intergenic
1013877782 6:114855480-114855502 TGGCAGGAACGGCCTGCTTAGGG - Intergenic
1014606952 6:123487429-123487451 AGGAAGGAAGGGTAAACTTTAGG - Intronic
1025772710 7:64528165-64528187 AGGAAGGAATGGCCTGCTTGGGG - Intronic
1026476645 7:70741905-70741927 AGGAAGGCAAGGGATGCTTGAGG + Intronic
1035550221 8:517499-517521 AGAAAGGAATGGAATGCTTGGGG - Intronic
1039448901 8:37655450-37655472 AGGAAAGAACTGTAGGCTTTGGG + Intergenic
1041660635 8:60397824-60397846 AGGAAGAACCGGTATGCCTGTGG + Intergenic
1045508486 8:102795193-102795215 AGGAAAGAAGGGCATGCTTGGGG + Intergenic
1057734123 9:97637702-97637724 AGAAGGGAACAGTGTGCTTAAGG + Intronic
1057734202 9:97638550-97638572 AGAAGGGAACAGTGTGCTTAAGG + Intronic
1059287614 9:113188603-113188625 AGGAAGGAAAGGTAAGCGGAAGG + Intronic
1060777271 9:126384319-126384341 AGGAAGAAACGGTTTCCTGATGG + Intronic
1203436444 Un_GL000195v1:142385-142407 AGAAAGGAAAGGTATGCCTTTGG - Intergenic
1187477765 X:19627046-19627068 AGGGAGGTTGGGTATGCTTAAGG + Intronic
1187730686 X:22250938-22250960 AGGAAGGAAAGGTAGTCTTTGGG + Exonic
1188635189 X:32421177-32421199 TGCAAGGCACAGTATGCTTATGG + Intronic
1188842608 X:35035155-35035177 ATGAAGGAAGGGTTTTCTTAAGG - Intergenic
1189515114 X:41705812-41705834 AGGAAGGAACTGTCTGCAAAGGG - Intronic
1190163056 X:48047861-48047883 AGGAAGGCAAGGAATTCTTAGGG - Intronic
1197355541 X:125434458-125434480 AGGAAGGAACCGTCTGTTCAGGG + Intergenic