ID: 1005606136

View in Genome Browser
Species Human (GRCh38)
Location 6:27479317-27479339
Sequence CCAATACCTGCGCTCCGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005606136_1005606143 27 Left 1005606136 6:27479317-27479339 CCTCAACGGAGCGCAGGTATTGG No data
Right 1005606143 6:27479367-27479389 AACCAACCGATGCACCTTTCGGG No data
1005606136_1005606142 26 Left 1005606136 6:27479317-27479339 CCTCAACGGAGCGCAGGTATTGG No data
Right 1005606142 6:27479366-27479388 AAACCAACCGATGCACCTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005606136 Original CRISPR CCAATACCTGCGCTCCGTTG AGG (reversed) Intergenic
No off target data available for this crispr