ID: 1005609222

View in Genome Browser
Species Human (GRCh38)
Location 6:27507491-27507513
Sequence CACCAGGAAGCTCGTGCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005609218_1005609222 -4 Left 1005609218 6:27507472-27507494 CCTTAGCACTTCTCCATTCCACC No data
Right 1005609222 6:27507491-27507513 CACCAGGAAGCTCGTGCAAATGG No data
1005609217_1005609222 10 Left 1005609217 6:27507458-27507480 CCTTGCTGTTGCTGCCTTAGCAC No data
Right 1005609222 6:27507491-27507513 CACCAGGAAGCTCGTGCAAATGG No data
1005609216_1005609222 30 Left 1005609216 6:27507438-27507460 CCATGTTCTTGGAACAAGATCCT No data
Right 1005609222 6:27507491-27507513 CACCAGGAAGCTCGTGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005609222 Original CRISPR CACCAGGAAGCTCGTGCAAA TGG Intergenic
No off target data available for this crispr