ID: 1005609555 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:27510553-27510575 |
Sequence | TAATACCTTCAGCATGGGCA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1005609555_1005609560 | -1 | Left | 1005609555 | 6:27510553-27510575 | CCCTGCCCATGCTGAAGGTATTA | No data | ||
Right | 1005609560 | 6:27510575-27510597 | AAACTGCAAATTGAAGGTGAAGG | No data | ||||
1005609555_1005609559 | -7 | Left | 1005609555 | 6:27510553-27510575 | CCCTGCCCATGCTGAAGGTATTA | No data | ||
Right | 1005609559 | 6:27510569-27510591 | GGTATTAAACTGCAAATTGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1005609555 | Original CRISPR | TAATACCTTCAGCATGGGCA GGG (reversed) | Intergenic | ||
No off target data available for this crispr |