ID: 1005609555

View in Genome Browser
Species Human (GRCh38)
Location 6:27510553-27510575
Sequence TAATACCTTCAGCATGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005609555_1005609560 -1 Left 1005609555 6:27510553-27510575 CCCTGCCCATGCTGAAGGTATTA No data
Right 1005609560 6:27510575-27510597 AAACTGCAAATTGAAGGTGAAGG No data
1005609555_1005609559 -7 Left 1005609555 6:27510553-27510575 CCCTGCCCATGCTGAAGGTATTA No data
Right 1005609559 6:27510569-27510591 GGTATTAAACTGCAAATTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005609555 Original CRISPR TAATACCTTCAGCATGGGCA GGG (reversed) Intergenic
No off target data available for this crispr