ID: 1005622824

View in Genome Browser
Species Human (GRCh38)
Location 6:27635670-27635692
Sequence TTGTAAACTCTGATGAAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005622824_1005622833 30 Left 1005622824 6:27635670-27635692 CCCGGCTTCATCAGAGTTTACAA No data
Right 1005622833 6:27635723-27635745 CTTACACATCCCCAATTTCAGGG No data
1005622824_1005622826 2 Left 1005622824 6:27635670-27635692 CCCGGCTTCATCAGAGTTTACAA No data
Right 1005622826 6:27635695-27635717 TCAGTGCCCCCAGCTTCATCAGG No data
1005622824_1005622832 29 Left 1005622824 6:27635670-27635692 CCCGGCTTCATCAGAGTTTACAA No data
Right 1005622832 6:27635722-27635744 TCTTACACATCCCCAATTTCAGG No data
1005622824_1005622827 3 Left 1005622824 6:27635670-27635692 CCCGGCTTCATCAGAGTTTACAA No data
Right 1005622827 6:27635696-27635718 CAGTGCCCCCAGCTTCATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005622824 Original CRISPR TTGTAAACTCTGATGAAGCC GGG (reversed) Intergenic
No off target data available for this crispr