ID: 1005632219

View in Genome Browser
Species Human (GRCh38)
Location 6:27719091-27719113
Sequence GACTCACAGTTCCACGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22098
Summary {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005632217_1005632219 16 Left 1005632217 6:27719052-27719074 CCAAGACTGGGTAATTCATAAAG 0: 84
1: 3592
2: 4506
3: 3287
4: 3158
Right 1005632219 6:27719091-27719113 GACTCACAGTTCCACGTGACTGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083
1005632216_1005632219 17 Left 1005632216 6:27719051-27719073 CCCAAGACTGGGTAATTCATAAA 0: 60
1: 2867
2: 11043
3: 14624
4: 13237
Right 1005632219 6:27719091-27719113 GACTCACAGTTCCACGTGACTGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005632219 Original CRISPR GACTCACAGTTCCACGTGAC TGG Intergenic
Too many off-targets to display for this crispr