ID: 1005634260

View in Genome Browser
Species Human (GRCh38)
Location 6:27738500-27738522
Sequence ACAGCCATTGACTGGCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005634260_1005634269 13 Left 1005634260 6:27738500-27738522 CCAGCCAGCCAGTCAATGGCTGT No data
Right 1005634269 6:27738536-27738558 CGCCTCGGGCTCAGCGTAGGTGG No data
1005634260_1005634266 10 Left 1005634260 6:27738500-27738522 CCAGCCAGCCAGTCAATGGCTGT No data
Right 1005634266 6:27738533-27738555 TCCCGCCTCGGGCTCAGCGTAGG No data
1005634260_1005634271 18 Left 1005634260 6:27738500-27738522 CCAGCCAGCCAGTCAATGGCTGT No data
Right 1005634271 6:27738541-27738563 CGGGCTCAGCGTAGGTGGAGCGG No data
1005634260_1005634264 -1 Left 1005634260 6:27738500-27738522 CCAGCCAGCCAGTCAATGGCTGT No data
Right 1005634264 6:27738522-27738544 TGTCCAGAGCTTCCCGCCTCGGG No data
1005634260_1005634263 -2 Left 1005634260 6:27738500-27738522 CCAGCCAGCCAGTCAATGGCTGT No data
Right 1005634263 6:27738521-27738543 GTGTCCAGAGCTTCCCGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005634260 Original CRISPR ACAGCCATTGACTGGCTGGC TGG (reversed) Intergenic
No off target data available for this crispr