ID: 1005637621

View in Genome Browser
Species Human (GRCh38)
Location 6:27766688-27766710
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005637621_1005637629 12 Left 1005637621 6:27766688-27766710 CCCTGGCCCTAACACAAGTTCTC No data
Right 1005637629 6:27766723-27766745 TTTTTAAACTGAAACAGGTGTGG No data
1005637621_1005637631 30 Left 1005637621 6:27766688-27766710 CCCTGGCCCTAACACAAGTTCTC No data
Right 1005637631 6:27766741-27766763 TGTGGAACCAAGGTCTCCACTGG No data
1005637621_1005637627 7 Left 1005637621 6:27766688-27766710 CCCTGGCCCTAACACAAGTTCTC No data
Right 1005637627 6:27766718-27766740 ACACCTTTTTAAACTGAAACAGG No data
1005637621_1005637630 20 Left 1005637621 6:27766688-27766710 CCCTGGCCCTAACACAAGTTCTC No data
Right 1005637630 6:27766731-27766753 CTGAAACAGGTGTGGAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005637621 Original CRISPR GAGAACTTGTGTTAGGGCCA GGG (reversed) Intergenic