ID: 1005637624

View in Genome Browser
Species Human (GRCh38)
Location 6:27766695-27766717
Sequence GGGTACAGAGAACTTGTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005637624_1005637627 0 Left 1005637624 6:27766695-27766717 CCTAACACAAGTTCTCTGTACCC No data
Right 1005637627 6:27766718-27766740 ACACCTTTTTAAACTGAAACAGG No data
1005637624_1005637631 23 Left 1005637624 6:27766695-27766717 CCTAACACAAGTTCTCTGTACCC No data
Right 1005637631 6:27766741-27766763 TGTGGAACCAAGGTCTCCACTGG No data
1005637624_1005637629 5 Left 1005637624 6:27766695-27766717 CCTAACACAAGTTCTCTGTACCC No data
Right 1005637629 6:27766723-27766745 TTTTTAAACTGAAACAGGTGTGG No data
1005637624_1005637630 13 Left 1005637624 6:27766695-27766717 CCTAACACAAGTTCTCTGTACCC No data
Right 1005637630 6:27766731-27766753 CTGAAACAGGTGTGGAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005637624 Original CRISPR GGGTACAGAGAACTTGTGTT AGG (reversed) Intergenic
No off target data available for this crispr