ID: 1005637625

View in Genome Browser
Species Human (GRCh38)
Location 6:27766715-27766737
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005637625_1005637633 14 Left 1005637625 6:27766715-27766737 CCCACACCTTTTTAAACTGAAAC No data
Right 1005637633 6:27766752-27766774 GGTCTCCACTGGCCTCAGCCTGG No data
1005637625_1005637631 3 Left 1005637625 6:27766715-27766737 CCCACACCTTTTTAAACTGAAAC No data
Right 1005637631 6:27766741-27766763 TGTGGAACCAAGGTCTCCACTGG No data
1005637625_1005637630 -7 Left 1005637625 6:27766715-27766737 CCCACACCTTTTTAAACTGAAAC No data
Right 1005637630 6:27766731-27766753 CTGAAACAGGTGTGGAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005637625 Original CRISPR GTTTCAGTTTAAAAAGGTGT GGG (reversed) Intergenic