ID: 1005637627

View in Genome Browser
Species Human (GRCh38)
Location 6:27766718-27766740
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005637623_1005637627 1 Left 1005637623 6:27766694-27766716 CCCTAACACAAGTTCTCTGTACC No data
Right 1005637627 6:27766718-27766740 ACACCTTTTTAAACTGAAACAGG No data
1005637622_1005637627 6 Left 1005637622 6:27766689-27766711 CCTGGCCCTAACACAAGTTCTCT No data
Right 1005637627 6:27766718-27766740 ACACCTTTTTAAACTGAAACAGG No data
1005637624_1005637627 0 Left 1005637624 6:27766695-27766717 CCTAACACAAGTTCTCTGTACCC No data
Right 1005637627 6:27766718-27766740 ACACCTTTTTAAACTGAAACAGG No data
1005637621_1005637627 7 Left 1005637621 6:27766688-27766710 CCCTGGCCCTAACACAAGTTCTC No data
Right 1005637627 6:27766718-27766740 ACACCTTTTTAAACTGAAACAGG No data
1005637619_1005637627 28 Left 1005637619 6:27766667-27766689 CCTCTCTGGGAGAGTCATCTTCC No data
Right 1005637627 6:27766718-27766740 ACACCTTTTTAAACTGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005637627 Original CRISPR ACACCTTTTTAAACTGAAAC AGG Intergenic