ID: 1005637628

View in Genome Browser
Species Human (GRCh38)
Location 6:27766721-27766743
Sequence ACACCTGTTTCAGTTTAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005637628_1005637631 -3 Left 1005637628 6:27766721-27766743 CCTTTTTAAACTGAAACAGGTGT No data
Right 1005637631 6:27766741-27766763 TGTGGAACCAAGGTCTCCACTGG No data
1005637628_1005637633 8 Left 1005637628 6:27766721-27766743 CCTTTTTAAACTGAAACAGGTGT No data
Right 1005637633 6:27766752-27766774 GGTCTCCACTGGCCTCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005637628 Original CRISPR ACACCTGTTTCAGTTTAAAA AGG (reversed) Intergenic
No off target data available for this crispr