ID: 1005637629

View in Genome Browser
Species Human (GRCh38)
Location 6:27766723-27766745
Sequence TTTTTAAACTGAAACAGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005637621_1005637629 12 Left 1005637621 6:27766688-27766710 CCCTGGCCCTAACACAAGTTCTC No data
Right 1005637629 6:27766723-27766745 TTTTTAAACTGAAACAGGTGTGG No data
1005637624_1005637629 5 Left 1005637624 6:27766695-27766717 CCTAACACAAGTTCTCTGTACCC No data
Right 1005637629 6:27766723-27766745 TTTTTAAACTGAAACAGGTGTGG No data
1005637623_1005637629 6 Left 1005637623 6:27766694-27766716 CCCTAACACAAGTTCTCTGTACC No data
Right 1005637629 6:27766723-27766745 TTTTTAAACTGAAACAGGTGTGG No data
1005637622_1005637629 11 Left 1005637622 6:27766689-27766711 CCTGGCCCTAACACAAGTTCTCT No data
Right 1005637629 6:27766723-27766745 TTTTTAAACTGAAACAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005637629 Original CRISPR TTTTTAAACTGAAACAGGTG TGG Intergenic
No off target data available for this crispr