ID: 1005637630

View in Genome Browser
Species Human (GRCh38)
Location 6:27766731-27766753
Sequence CTGAAACAGGTGTGGAACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005637623_1005637630 14 Left 1005637623 6:27766694-27766716 CCCTAACACAAGTTCTCTGTACC No data
Right 1005637630 6:27766731-27766753 CTGAAACAGGTGTGGAACCAAGG No data
1005637625_1005637630 -7 Left 1005637625 6:27766715-27766737 CCCACACCTTTTTAAACTGAAAC No data
Right 1005637630 6:27766731-27766753 CTGAAACAGGTGTGGAACCAAGG No data
1005637626_1005637630 -8 Left 1005637626 6:27766716-27766738 CCACACCTTTTTAAACTGAAACA No data
Right 1005637630 6:27766731-27766753 CTGAAACAGGTGTGGAACCAAGG No data
1005637624_1005637630 13 Left 1005637624 6:27766695-27766717 CCTAACACAAGTTCTCTGTACCC No data
Right 1005637630 6:27766731-27766753 CTGAAACAGGTGTGGAACCAAGG No data
1005637621_1005637630 20 Left 1005637621 6:27766688-27766710 CCCTGGCCCTAACACAAGTTCTC No data
Right 1005637630 6:27766731-27766753 CTGAAACAGGTGTGGAACCAAGG No data
1005637622_1005637630 19 Left 1005637622 6:27766689-27766711 CCTGGCCCTAACACAAGTTCTCT No data
Right 1005637630 6:27766731-27766753 CTGAAACAGGTGTGGAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005637630 Original CRISPR CTGAAACAGGTGTGGAACCA AGG Intergenic
No off target data available for this crispr