ID: 1005637631

View in Genome Browser
Species Human (GRCh38)
Location 6:27766741-27766763
Sequence TGTGGAACCAAGGTCTCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005637622_1005637631 29 Left 1005637622 6:27766689-27766711 CCTGGCCCTAACACAAGTTCTCT No data
Right 1005637631 6:27766741-27766763 TGTGGAACCAAGGTCTCCACTGG No data
1005637625_1005637631 3 Left 1005637625 6:27766715-27766737 CCCACACCTTTTTAAACTGAAAC No data
Right 1005637631 6:27766741-27766763 TGTGGAACCAAGGTCTCCACTGG No data
1005637628_1005637631 -3 Left 1005637628 6:27766721-27766743 CCTTTTTAAACTGAAACAGGTGT No data
Right 1005637631 6:27766741-27766763 TGTGGAACCAAGGTCTCCACTGG No data
1005637621_1005637631 30 Left 1005637621 6:27766688-27766710 CCCTGGCCCTAACACAAGTTCTC No data
Right 1005637631 6:27766741-27766763 TGTGGAACCAAGGTCTCCACTGG No data
1005637623_1005637631 24 Left 1005637623 6:27766694-27766716 CCCTAACACAAGTTCTCTGTACC No data
Right 1005637631 6:27766741-27766763 TGTGGAACCAAGGTCTCCACTGG No data
1005637624_1005637631 23 Left 1005637624 6:27766695-27766717 CCTAACACAAGTTCTCTGTACCC No data
Right 1005637631 6:27766741-27766763 TGTGGAACCAAGGTCTCCACTGG No data
1005637626_1005637631 2 Left 1005637626 6:27766716-27766738 CCACACCTTTTTAAACTGAAACA No data
Right 1005637631 6:27766741-27766763 TGTGGAACCAAGGTCTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005637631 Original CRISPR TGTGGAACCAAGGTCTCCAC TGG Intergenic
No off target data available for this crispr