ID: 1005637633

View in Genome Browser
Species Human (GRCh38)
Location 6:27766752-27766774
Sequence GGTCTCCACTGGCCTCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005637625_1005637633 14 Left 1005637625 6:27766715-27766737 CCCACACCTTTTTAAACTGAAAC No data
Right 1005637633 6:27766752-27766774 GGTCTCCACTGGCCTCAGCCTGG No data
1005637626_1005637633 13 Left 1005637626 6:27766716-27766738 CCACACCTTTTTAAACTGAAACA No data
Right 1005637633 6:27766752-27766774 GGTCTCCACTGGCCTCAGCCTGG No data
1005637628_1005637633 8 Left 1005637628 6:27766721-27766743 CCTTTTTAAACTGAAACAGGTGT No data
Right 1005637633 6:27766752-27766774 GGTCTCCACTGGCCTCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005637633 Original CRISPR GGTCTCCACTGGCCTCAGCC TGG Intergenic
No off target data available for this crispr