ID: 1005639180

View in Genome Browser
Species Human (GRCh38)
Location 6:27778524-27778546
Sequence CTGTAAGTATGGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005639180_1005639185 -8 Left 1005639180 6:27778524-27778546 CCCTCCTCCTTCCATACTTACAG No data
Right 1005639185 6:27778539-27778561 ACTTACAGAAACTAGACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005639180 Original CRISPR CTGTAAGTATGGAAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr