ID: 1005639408

View in Genome Browser
Species Human (GRCh38)
Location 6:27781807-27781829
Sequence ATGCCTTTTTAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005639408_1005639410 2 Left 1005639408 6:27781807-27781829 CCTTCACTCTTCTAAAAAGGCAT No data
Right 1005639410 6:27781832-27781854 TTTGTTAGGTCCTTTTTCCATGG 0: 39
1: 40
2: 27
3: 29
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005639408 Original CRISPR ATGCCTTTTTAGAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr