ID: 1005640543

View in Genome Browser
Species Human (GRCh38)
Location 6:27792163-27792185
Sequence CAGCAATCAGCTGTGGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005640543_1005640551 7 Left 1005640543 6:27792163-27792185 CCCTACACCACAGCTGATTGCTG No data
Right 1005640551 6:27792193-27792215 TCTCTGGGGATGTTCTCAGTCGG No data
1005640543_1005640548 -9 Left 1005640543 6:27792163-27792185 CCCTACACCACAGCTGATTGCTG No data
Right 1005640548 6:27792177-27792199 TGATTGCTGCGATGGGTCTCTGG No data
1005640543_1005640549 -8 Left 1005640543 6:27792163-27792185 CCCTACACCACAGCTGATTGCTG No data
Right 1005640549 6:27792178-27792200 GATTGCTGCGATGGGTCTCTGGG No data
1005640543_1005640550 -7 Left 1005640543 6:27792163-27792185 CCCTACACCACAGCTGATTGCTG No data
Right 1005640550 6:27792179-27792201 ATTGCTGCGATGGGTCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005640543 Original CRISPR CAGCAATCAGCTGTGGTGTA GGG (reversed) Intergenic
No off target data available for this crispr