ID: 1005641695

View in Genome Browser
Species Human (GRCh38)
Location 6:27802303-27802325
Sequence CCAATTTGGAAGCAGAGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005641687_1005641695 7 Left 1005641687 6:27802273-27802295 CCTTCCCCCAAAGACACAGGACT No data
Right 1005641695 6:27802303-27802325 CCAATTTGGAAGCAGAGACCTGG No data
1005641688_1005641695 3 Left 1005641688 6:27802277-27802299 CCCCCAAAGACACAGGACTCAAG No data
Right 1005641695 6:27802303-27802325 CCAATTTGGAAGCAGAGACCTGG No data
1005641683_1005641695 15 Left 1005641683 6:27802265-27802287 CCCCACAACCTTCCCCCAAAGAC No data
Right 1005641695 6:27802303-27802325 CCAATTTGGAAGCAGAGACCTGG No data
1005641685_1005641695 13 Left 1005641685 6:27802267-27802289 CCACAACCTTCCCCCAAAGACAC No data
Right 1005641695 6:27802303-27802325 CCAATTTGGAAGCAGAGACCTGG No data
1005641692_1005641695 0 Left 1005641692 6:27802280-27802302 CCAAAGACACAGGACTCAAGGTG No data
Right 1005641695 6:27802303-27802325 CCAATTTGGAAGCAGAGACCTGG No data
1005641684_1005641695 14 Left 1005641684 6:27802266-27802288 CCCACAACCTTCCCCCAAAGACA No data
Right 1005641695 6:27802303-27802325 CCAATTTGGAAGCAGAGACCTGG No data
1005641691_1005641695 1 Left 1005641691 6:27802279-27802301 CCCAAAGACACAGGACTCAAGGT No data
Right 1005641695 6:27802303-27802325 CCAATTTGGAAGCAGAGACCTGG No data
1005641689_1005641695 2 Left 1005641689 6:27802278-27802300 CCCCAAAGACACAGGACTCAAGG No data
Right 1005641695 6:27802303-27802325 CCAATTTGGAAGCAGAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005641695 Original CRISPR CCAATTTGGAAGCAGAGACC TGG Intergenic
No off target data available for this crispr