ID: 1005643990

View in Genome Browser
Species Human (GRCh38)
Location 6:27824229-27824251
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 2, 1: 1, 2: 4, 3: 11, 4: 102}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005643990_1005643995 10 Left 1005643990 6:27824229-27824251 CCGGCGCCTTGCTCGCCGCGGCG 0: 2
1: 1
2: 4
3: 11
4: 102
Right 1005643995 6:27824262-27824284 CATCTCCGGCCTCATCTACGAGG 0: 2
1: 0
2: 0
3: 11
4: 65
1005643990_1005643994 -4 Left 1005643990 6:27824229-27824251 CCGGCGCCTTGCTCGCCGCGGCG 0: 2
1: 1
2: 4
3: 11
4: 102
Right 1005643994 6:27824248-27824270 GGCGGCGTGAAGCGCATCTCCGG 0: 2
1: 1
2: 5
3: 5
4: 44
1005643990_1005643998 20 Left 1005643990 6:27824229-27824251 CCGGCGCCTTGCTCGCCGCGGCG 0: 2
1: 1
2: 4
3: 11
4: 102
Right 1005643998 6:27824272-27824294 CTCATCTACGAGGAGACTCGCGG 0: 3
1: 2
2: 5
3: 3
4: 36
1005643990_1005644000 22 Left 1005643990 6:27824229-27824251 CCGGCGCCTTGCTCGCCGCGGCG 0: 2
1: 1
2: 4
3: 11
4: 102
Right 1005644000 6:27824274-27824296 CATCTACGAGGAGACTCGCGGGG 0: 3
1: 1
2: 0
3: 2
4: 25
1005643990_1005643999 21 Left 1005643990 6:27824229-27824251 CCGGCGCCTTGCTCGCCGCGGCG 0: 2
1: 1
2: 4
3: 11
4: 102
Right 1005643999 6:27824273-27824295 TCATCTACGAGGAGACTCGCGGG 0: 3
1: 1
2: 0
3: 3
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005643990 Original CRISPR CGCCGCGGCGAGCAAGGCGC CGG (reversed) Exonic
900113657 1:1019894-1019916 CGCCGCCGCGAACAAAGCCCCGG - Intergenic
900370967 1:2331983-2332005 CGCAGCGGCGGGAGAGGCGCAGG - Intronic
902600890 1:17539694-17539716 CGCCGCGTCGCGCACGGCGGCGG + Intergenic
903652993 1:24932422-24932444 CTCCGCGGCTGGCAGGGCGCGGG - Intronic
905588799 1:39144034-39144056 CGCCTCGGCCACCAAGGTGCTGG + Intronic
905862548 1:41361203-41361225 CTCCGCGCCGAGCAGGGGGCGGG + Intergenic
911618355 1:100038606-100038628 CGCCGCGGGGAGGAATGTGCGGG + Intronic
912270139 1:108200274-108200296 GGCTGCGGCGCGCAGGGCGCAGG + Exonic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
922416579 1:225427911-225427933 CGCCGCGGGGAGCTGGGAGCAGG + Intronic
922506209 1:226127310-226127332 CGCCGCGGCCAAGAAGACGCTGG + Intergenic
1064028794 10:11869976-11869998 CCCCGCGGCGGGGAAGGCGCCGG - Exonic
1066220748 10:33335085-33335107 CTCCGCGGGAAGGAAGGCGCTGG + Intronic
1069352072 10:67539566-67539588 CACCGCAGCCAGCAAGGCACGGG + Exonic
1069473876 10:68716307-68716329 AGCTTCGGCTAGCAAGGCGCTGG + Intergenic
1070329607 10:75408109-75408131 CGCCGCGGCGCGCTCGGCCCCGG + Intergenic
1070660618 10:78303108-78303130 CGCGGCGGCGGGAAAGGCCCTGG + Intergenic
1071086633 10:81874549-81874571 CGCCGCCGCGAGCCAGGGGCTGG - Intergenic
1073325570 10:102642667-102642689 CGCCGCCGCGAGGAAGGCGGCGG - Intergenic
1083333964 11:61912241-61912263 CGCCCCGGGGAGCCAGGCCCTGG - Intronic
1083617975 11:64035821-64035843 GGCGGCGGCGAGCAGGGCGCGGG - Intronic
1084102299 11:66957857-66957879 AGCCGCGGCGTGTAAGGCGAGGG - Intronic
1084673000 11:70618664-70618686 CGACTGGGAGAGCAAGGCGCAGG + Intronic
1085474846 11:76783317-76783339 CGCCGCGCGGAGAAAAGCGCTGG + Intronic
1087175295 11:95090176-95090198 CGCCGCCGGGCGCAGGGCGCGGG - Exonic
1093164468 12:15789319-15789341 CTCCGAGGCGAGCACAGCGCCGG + Exonic
1094041166 12:26122816-26122838 CTCGGCGGCGAGCTCGGCGCTGG + Exonic
1103958550 12:124593288-124593310 TGCCGGGGAGAGCAAGGAGCTGG - Intergenic
1104203549 12:126615098-126615120 CCCCGCGATGAGCAAGGCGTGGG + Intergenic
1106517144 13:30465324-30465346 CGCCGCAGCGAGCCGGGCGCTGG - Intronic
1106602561 13:31200226-31200248 CGGCGCGGGGAGGGAGGCGCAGG + Intronic
1111396073 13:87671837-87671859 CGCAGCGGCGACCACCGCGCTGG - Intergenic
1121190643 14:92026466-92026488 GGCTGCGGCGAGCAAGGAGGCGG - Intronic
1121342957 14:93115909-93115931 CGCGGCGGCGAGGAAGCGGCGGG + Intronic
1122905694 14:104800590-104800612 CGCCCCGGCGGGGAGGGCGCGGG - Intronic
1124966726 15:34437425-34437447 CGGCGCGGCGAGGACGGCGGCGG - Intronic
1125429502 15:39581066-39581088 CGCAGCGGCTGGCAAGGCGGAGG - Intronic
1125689604 15:41585483-41585505 CCCCGCGGCCTGCAGGGCGCCGG - Intergenic
1126766999 15:52019431-52019453 CGCCGCGGCGGGCCCGGCGGCGG + Intronic
1129273970 15:74433520-74433542 CGCTGCGGCGAGCGAGCGGCGGG - Intronic
1136479365 16:30532319-30532341 GGCAGCGGGGAGCAAGGTGCTGG + Exonic
1138381871 16:56608343-56608365 CGCCTCGGCGCGGAAGGGGCTGG - Exonic
1138450726 16:57092408-57092430 TGCCGCGGCGCGCCGGGCGCGGG + Intergenic
1141828990 16:86498999-86499021 CTCGGCGGCCAGGAAGGCGCCGG - Intergenic
1147612846 17:41811906-41811928 CGGCGCGGCGGGCATGGCTCGGG - Exonic
1148206971 17:45785033-45785055 CGCCGCGGAGGGGAAGGGGCAGG - Intronic
1150069439 17:62139011-62139033 TGCCGCGGCAAGCAAGGCTCGGG + Intergenic
1151812597 17:76453178-76453200 AGCGGCGGCGAACGAGGCGCGGG + Exonic
1151836431 17:76585631-76585653 CGCAGGGGCGACCAGGGCGCGGG - Intronic
1152644120 17:81460990-81461012 GGCAGCGGCCAGCAAGGGGCCGG + Exonic
1160122797 18:76145675-76145697 CACCGCGGCGCCCCAGGCGCGGG - Intergenic
1162372973 19:10290021-10290043 CGCCGCGGCGGGGAAAGCACAGG - Exonic
1162506569 19:11089580-11089602 CGCGGCGAGGAGCAAGGCGACGG - Exonic
1163444371 19:17338164-17338186 TGGCGTGGCGAGCAAGGGGCAGG - Exonic
1165080480 19:33303394-33303416 CGCCGGGGCGAGCACGGGGAGGG + Intergenic
1166984184 19:46649697-46649719 CGCCACGGCGTGCAGGGGGCTGG + Exonic
1167843378 19:52139996-52140018 AGCCGCGACCAGCAAGGGGCGGG + Intergenic
925023275 2:588242-588264 CTCCGTGGTGAGCAAGGCTCAGG + Intergenic
925419953 2:3703721-3703743 GGCCCCGGCGAGCGAGGAGCGGG + Exonic
947596069 2:231412452-231412474 CCCCGCGAGGAGCAAGGGGCTGG + Intergenic
947641154 2:231708570-231708592 GGCTGCGGCGAGCAAGGAGGCGG - Exonic
1169143556 20:3238931-3238953 AGCCGCGGGGAGGAGGGCGCGGG - Intronic
1170623323 20:18011835-18011857 GGCTGCGGCGAGCAAGGAGCCGG - Intronic
1185055257 22:48575853-48575875 CGCCGCGGCGGGCCAGGCTCGGG - Intronic
1185343704 22:50302411-50302433 CTCCGCGTGGAGCAAGGGGCTGG - Intronic
950729772 3:14947548-14947570 CGCGGCGGCGAGGCTGGCGCTGG + Intergenic
950729850 3:14947824-14947846 CGGCGCGGAGGGCAGGGCGCGGG - Intronic
961305703 3:125958296-125958318 GGCTGCCGCGAGCTAGGCGCTGG + Intergenic
961539750 3:127591254-127591276 CGCCGCGTGGAGCAGGGCGCTGG - Intronic
962283335 3:134067934-134067956 CCCCGGGGCGAGGAAGGCACAGG + Intronic
968258190 3:197297998-197298020 GGCCGCGGCGAGCGAGGAGGCGG - Intronic
968512785 4:1002834-1002856 CACCGCGGCGCGCCAGGCGTCGG - Exonic
969413040 4:7042383-7042405 CGGCGCGGAGAGCAAGGAGAGGG - Exonic
969566974 4:7984478-7984500 CCACACGGGGAGCAAGGCGCAGG + Intronic
969873186 4:10117005-10117027 GGGCGGGGCGAGCAAGGCGGAGG - Intergenic
969912118 4:10456939-10456961 CGCCGGGGCGACCGAGGCGGGGG - Intronic
981076594 4:140598534-140598556 CTCCGCCATGAGCAAGGCGCAGG + Intergenic
986608256 5:9544809-9544831 CGCCGCGGGGAGCGAGCCGGGGG + Intronic
987132332 5:14871524-14871546 CGACGGGGCGAGCGGGGCGCGGG + Exonic
992769599 5:80035200-80035222 GGCCGCAGGGAGAAAGGCGCGGG - Intronic
997560974 5:134846048-134846070 GGCGGCGGCGAGGCAGGCGCTGG - Exonic
999768170 5:154756040-154756062 GGCGGCGGCGAGCCAGGCGCTGG + Intronic
1002637385 5:180615077-180615099 CACCGCACGGAGCAAGGCGCGGG + Intronic
1005473927 6:26188950-26188972 CGCCGCGGCGAGCCAGGCGGCGG + Exonic
1005475615 6:26204749-26204771 CCCCGCGACGAGCAAGGCGCCGG - Exonic
1005484327 6:26285373-26285395 CGCCGCGACGAGCAAGGCGCCGG + Exonic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1006752567 6:36387816-36387838 CGCCGCTGCGGGCTAGGAGCAGG + Intergenic
1008378688 6:50819878-50819900 GGCCGAGGCGGGCGAGGCGCGGG + Intronic
1008932374 6:56954573-56954595 AGCCGCGGCGATCATGGTGCGGG + Intronic
1016433137 6:144008419-144008441 CGCGGCCGCGAGGAGGGCGCTGG + Intronic
1016597009 6:145814552-145814574 CGCCGCAGCGCGGACGGCGCCGG + Intronic
1017103220 6:150866124-150866146 CGCCGTGGGGAGCGGGGCGCGGG + Intronic
1019536252 7:1531147-1531169 CGGCGCGGCAAGCATGGCCCGGG - Intronic
1019926494 7:4196527-4196549 CGGCGTGGAGAGCAAGGGGCAGG - Intronic
1020018435 7:4846007-4846029 CACCGCGTCCAGCATGGCGCTGG + Intronic
1020105704 7:5421355-5421377 CTCCGCGGCGTGCATGGCGGCGG + Exonic
1026045673 7:66904076-66904098 CGCAGCCACGAGCAAGGAGCTGG - Intergenic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1028987667 7:97021113-97021135 CGCCGCCCCGGGGAAGGCGCGGG - Intronic
1029054925 7:97732203-97732225 AGCCGCGGCCAGCACCGCGCGGG - Intronic
1033741883 7:144282426-144282448 TGCCGCGGAGAGCTAGGCCCGGG + Intergenic
1033752018 7:144367188-144367210 TGCCGCGGAGAGCTAGGCCCGGG - Exonic
1036788657 8:11703850-11703872 CGCAGCGGCGGGCGAGGGGCGGG - Intronic
1038540342 8:28385856-28385878 GGCCGCGGCGGGCGGGGCGCGGG - Intronic
1043428424 8:80171418-80171440 GACCGCGGCGAGCAAGGTGAGGG - Intronic
1047615020 8:126556831-126556853 CGCCGTGGTGCGCAACGCGCTGG - Exonic
1049156858 8:141072718-141072740 AGCCCCGGCGAGCAAGGCCTGGG + Intergenic
1049774423 8:144397899-144397921 CTCAGCGGCGGGCAAGGGGCAGG + Intronic
1057358022 9:94347659-94347681 AGCCGCGGCGAGCAAGGAGCTGG + Intergenic
1057649727 9:96909958-96909980 AGCCGCGGCGAGCAAGGAGCTGG - Intronic
1061623005 9:131823946-131823968 CGCCGCGGAGAGCCCGGCGCCGG + Intergenic
1185778768 X:2828723-2828745 GGCCGCGGCGGGCGAGGGGCGGG + Intergenic
1191797277 X:65034787-65034809 CGCCGCGGCGATAACCGCGCCGG + Intergenic
1191830206 X:65407585-65407607 GGCGGCGGCGGGCGAGGCGCAGG - Intronic
1200292592 X:154886739-154886761 CACCGCGGCGCCCAGGGCGCTGG - Exonic
1200339436 X:155382479-155382501 CACCGCGGCGCCCAGGGCGCTGG - Exonic
1200347034 X:155458214-155458236 CACCGCGGCGCCCAGGGCGCTGG + Exonic
1201489447 Y:14524780-14524802 CACCGCGGAGTGGAAGGCGCAGG - Intronic