ID: 1005643999

View in Genome Browser
Species Human (GRCh38)
Location 6:27824273-27824295
Sequence TCATCTACGAGGAGACTCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 3, 1: 1, 2: 0, 3: 3, 4: 19}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005643990_1005643999 21 Left 1005643990 6:27824229-27824251 CCGGCGCCTTGCTCGCCGCGGCG 0: 2
1: 1
2: 4
3: 11
4: 102
Right 1005643999 6:27824273-27824295 TCATCTACGAGGAGACTCGCGGG 0: 3
1: 1
2: 0
3: 3
4: 19
1005643988_1005643999 25 Left 1005643988 6:27824225-27824247 CCATCCGGCGCCTTGCTCGCCGC 0: 2
1: 2
2: 0
3: 5
4: 80
Right 1005643999 6:27824273-27824295 TCATCTACGAGGAGACTCGCGGG 0: 3
1: 1
2: 0
3: 3
4: 19
1005643993_1005643999 6 Left 1005643993 6:27824244-27824266 CCGCGGCGGCGTGAAGCGCATCT 0: 2
1: 1
2: 0
3: 2
4: 22
Right 1005643999 6:27824273-27824295 TCATCTACGAGGAGACTCGCGGG 0: 3
1: 1
2: 0
3: 3
4: 19
1005643992_1005643999 15 Left 1005643992 6:27824235-27824257 CCTTGCTCGCCGCGGCGGCGTGA 0: 3
1: 0
2: 1
3: 5
4: 50
Right 1005643999 6:27824273-27824295 TCATCTACGAGGAGACTCGCGGG 0: 3
1: 1
2: 0
3: 3
4: 19
1005643987_1005643999 29 Left 1005643987 6:27824221-27824243 CCGGCCATCCGGCGCCTTGCTCG 0: 3
1: 2
2: 1
3: 12
4: 131
Right 1005643999 6:27824273-27824295 TCATCTACGAGGAGACTCGCGGG 0: 3
1: 1
2: 0
3: 3
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005643999 Original CRISPR TCATCTACGAGGAGACTCGC GGG Exonic
907801699 1:57772535-57772557 GCATCTAGGAGTAGACTCGCTGG + Intronic
1073174770 10:101548217-101548239 TCAACTAGGAGTAGACTTGCTGG - Intronic
1097712842 12:62934518-62934540 TCATCCTCAAGGAGACTCGGCGG - Exonic
1098409733 12:70168593-70168615 TCATCCTCAAGGAGACTGGCTGG + Intergenic
1139038044 16:62971467-62971489 TCATCTTCTAGGAGGCTAGCTGG + Intergenic
1143130382 17:4673619-4673641 TCATCAAGGAGGAGACTCACAGG - Exonic
926328125 2:11802993-11803015 TCAGCTACAAGAAGACTCTCCGG + Exonic
931748869 2:65313789-65313811 TCAACCACGAGGAGAACCGCCGG - Exonic
934098445 2:88628464-88628486 TCAACGAGGAGGAGACTGGCCGG + Intergenic
943502016 2:188703391-188703413 TCATCTACCAGTACACTCTCAGG + Intergenic
1173828129 20:46060321-46060343 TCATCTCCTAAGAGACTGGCAGG + Intergenic
958560061 3:95736816-95736838 TCAACTCCGAGGAGCCTCGTTGG + Intergenic
966942967 3:184758506-184758528 TCATCTACTGGGACACTGGCAGG - Intergenic
977868324 4:102058164-102058186 TTATTTACTAGGAGACTGGCTGG - Intronic
1002602799 5:180363587-180363609 TCATCTCAGAGGAGTCTTGCTGG + Intergenic
1005456192 6:26021827-26021849 TGATCTACGAGGAGACTCGCGGG + Exonic
1005475622 6:26204793-26204815 TCATCTACGAGGAGACTCGCGGG + Exonic
1005480009 6:26246807-26246829 TCATTTATGAGGAGACCCGCCGG - Exonic
1005643999 6:27824273-27824295 TCATCTACGAGGAGACTCGCGGG + Exonic
1005645198 6:27831357-27831379 TCATCTACGAGGAGACTCGCGGG - Exonic
1019273663 7:164673-164695 GGATCTGAGAGGAGACTCGCTGG - Intergenic
1021740262 7:23679913-23679935 TAATTTACAAGAAGACTCGCCGG + Intergenic
1021814308 7:24432763-24432785 TAATTTACAAGAAGACTCGCGGG + Intergenic
1030388686 7:108898802-108898824 TCATTTAGCAGGAGACTCACAGG - Intergenic
1043726295 8:83615162-83615184 TAAGCTACGAGGAGACATGCTGG - Intergenic
1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG + Intergenic