ID: 1005645203

View in Genome Browser
Species Human (GRCh38)
Location 6:27831382-27831404
Sequence GGCGGCGTGAAGCGCATCTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 2, 1: 1, 2: 5, 3: 5, 4: 44}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005645203_1005645210 4 Left 1005645203 6:27831382-27831404 CCGGAGATGCGCTTCACGCCGCC 0: 2
1: 1
2: 5
3: 5
4: 44
Right 1005645210 6:27831409-27831431 CGAGCAAGGCGCCGGATGGCCGG 0: 3
1: 2
2: 1
3: 12
4: 131
1005645203_1005645207 -4 Left 1005645203 6:27831382-27831404 CCGGAGATGCGCTTCACGCCGCC 0: 2
1: 1
2: 5
3: 5
4: 44
Right 1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG 0: 2
1: 1
2: 4
3: 11
4: 102
1005645203_1005645205 -10 Left 1005645203 6:27831382-27831404 CCGGAGATGCGCTTCACGCCGCC 0: 2
1: 1
2: 5
3: 5
4: 44
Right 1005645205 6:27831395-27831417 TCACGCCGCCGCGGCGAGCAAGG 0: 3
1: 0
2: 1
3: 5
4: 50
1005645203_1005645211 9 Left 1005645203 6:27831382-27831404 CCGGAGATGCGCTTCACGCCGCC 0: 2
1: 1
2: 5
3: 5
4: 44
Right 1005645211 6:27831414-27831436 AAGGCGCCGGATGGCCGGCTTGG 0: 2
1: 1
2: 3
3: 6
4: 43
1005645203_1005645209 0 Left 1005645203 6:27831382-27831404 CCGGAGATGCGCTTCACGCCGCC 0: 2
1: 1
2: 5
3: 5
4: 44
Right 1005645209 6:27831405-27831427 GCGGCGAGCAAGGCGCCGGATGG 0: 2
1: 2
2: 0
3: 5
4: 80
1005645203_1005645213 20 Left 1005645203 6:27831382-27831404 CCGGAGATGCGCTTCACGCCGCC 0: 2
1: 1
2: 5
3: 5
4: 44
Right 1005645213 6:27831425-27831447 TGGCCGGCTTGGTGATGCCCTGG 0: 3
1: 0
2: 4
3: 8
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005645203 Original CRISPR GGCGGCGTGAAGCGCATCTC CGG (reversed) Exonic
900181442 1:1312749-1312771 GGCGGCGTGGGGCCCACCTCGGG - Intronic
905491927 1:38351111-38351133 GGCGGGGAGAAGAGCATTTCAGG - Intergenic
914665971 1:149832808-149832830 GGCGGCGTTAAGCGGATCTCTGG + Intergenic
914669794 1:149860986-149861008 GGCGGCGTTAAGCGGATCTCTGG - Exonic
1067287997 10:44921434-44921456 GCCGGACTGAAGCACATCTCAGG + Intronic
1083416215 11:62527488-62527510 GGGGTCTTGAAGTGCATCTCAGG + Exonic
1083416280 11:62527872-62527894 GGGGTCTTGAAGTGCATCTCAGG + Exonic
1083416314 11:62528073-62528095 GGGGCCTTGAAGTGCATCTCAGG + Exonic
1083416381 11:62528457-62528479 GGGGTCTTGAAGTGCATCTCAGG + Exonic
1083416453 11:62528859-62528881 GGGGCCTTGAAGTGCATCTCAGG + Exonic
1083416692 11:62530455-62530477 GGGGCCTTGAAGTGCATCTCAGG + Exonic
1085022580 11:73218572-73218594 GCCGGCGTGTAGCGCATAACTGG + Intronic
1088738873 11:112750752-112750774 GGAGGCGTCAATCTCATCTCTGG - Intergenic
1093077269 12:14770939-14770961 GGGGGCGTCAAGCGCATTTCTGG - Exonic
1094658314 12:32441965-32441987 CATGGCGTGAAGAGCATCTCTGG - Intronic
1102549050 12:113677768-113677790 GGTGGGGTGAAGGGCATCCCAGG + Intergenic
1112567173 13:100561703-100561725 GGAGGTGTGAAGGGCATCCCGGG - Intronic
1113378819 13:109785583-109785605 GGCGGCGGGGGGCGCGTCTCCGG + Exonic
1113890928 13:113735295-113735317 GACGACATGAAGGGCATCTCCGG + Exonic
1123500841 15:20878911-20878933 GGCGGCAGGAGGCGCAGCTCCGG + Intergenic
1123558092 15:21452606-21452628 GGCGGCAGGAGGCGCAGCTCCGG + Intergenic
1123594320 15:21889887-21889909 GGCGGCAGGAGGCGCAGCTCCGG + Intergenic
1202966442 15_KI270727v1_random:179778-179800 GGCGGCAGGAGGCGCAGCTCCGG + Intergenic
1140866561 16:79067457-79067479 GGAGCCGAGAAGAGCATCTCAGG - Intronic
1149626387 17:58083474-58083496 GGCGGCGTGAGGCGGAGCGCGGG + Exonic
1167285514 19:48596748-48596770 GGCTCCGTGGAGCGCATCTGTGG + Exonic
1168344475 19:55643685-55643707 GGCGGCGAGAAGGGGACCTCTGG - Intronic
926885342 2:17592749-17592771 GGGGGAGTGTAGCGTATCTCTGG + Intronic
927692364 2:25216976-25216998 GGCGTGGTGACGCGCATCTGTGG + Intergenic
949074501 2:242046599-242046621 CGCTGCGGGAAGCCCATCTCTGG - Intergenic
1169082357 20:2805221-2805243 GAGGGCGGGAAGGGCATCTCCGG - Intergenic
1175561240 20:59933044-59933066 TGCGGCCTGGGGCGCATCTCGGG - Intronic
1179550932 21:42143325-42143347 GGAGGCCAGAAACGCATCTCTGG + Intronic
950345376 3:12287988-12288010 GGCGGCGTGGCGCCCCTCTCCGG - Intronic
966378782 3:179323171-179323193 GGCGGCGGGCAGCGCTGCTCCGG - Intronic
968160941 3:196426244-196426266 GGTGTCGTGACGCGCATCTGTGG + Intronic
971073286 4:23119569-23119591 GGTGGGGGGAAGAGCATCTCAGG + Intergenic
985423057 4:189803461-189803483 GGGGGCTTGCAGCGCTTCTCAGG - Intergenic
992743323 5:79795415-79795437 GGAGGCGTGAAGATCATCTCAGG + Intronic
1005456189 6:26021802-26021824 GGCGGTGTGAAGCGGATCTCTGG + Exonic
1005464977 6:26104071-26104093 GGTGGCGTCAAGCGCATTTCCGG + Exonic
1005473922 6:26188931-26188953 GGCGGCGTCAAGCGTATTTCTGG - Exonic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1005479324 6:26240549-26240571 GGCGGCGTGAAACGCATTTCGGG + Exonic
1005480012 6:26246832-26246854 GGCGGTGTCAAGCGCATCTTGGG - Exonic
1005484324 6:26285354-26285376 GGCGGTGTCAAGCGAATTTCTGG - Exonic
1005570361 6:27139432-27139454 GGCGGCGTGAAGCGCATTTCTGG + Exonic
1005643994 6:27824248-27824270 GGCGGCGTGAAGCGCATCTCCGG + Exonic
1005645203 6:27831382-27831404 GGCGGCGTGAAGCGCATCTCCGG - Exonic
1005649457 6:27873365-27873387 GGAGGCGTTAAGCGCATCTCAGG - Exonic
1007473377 6:42104745-42104767 GGGGGCCTGGAGCGCTTCTCGGG - Exonic
1011933340 6:92740993-92741015 GGCGTTGTGAAGTGCACCTCAGG + Intergenic
1032641553 7:133774768-133774790 GGCTGTATGAAGCTCATCTCTGG + Intronic
1045228226 8:100273003-100273025 GGCGTGGTGATGGGCATCTCTGG - Intronic
1049849406 8:144822782-144822804 GGCCGTTTGAAGTGCATCTCAGG - Intergenic
1057978331 9:99630733-99630755 GGCTGCGTGAAGCCAATCTACGG + Intergenic
1203561433 Un_KI270744v1:61063-61085 GGCGGCGGGCAGCTCAGCTCGGG + Intergenic