ID: 1005649454

View in Genome Browser
Species Human (GRCh38)
Location 6:27873341-27873363
Sequence CTTATATACGAGGAGACACG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 44}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005649454_1005649462 24 Left 1005649454 6:27873341-27873363 CCGCGTGTCTCCTCGTATATAAG 0: 1
1: 0
2: 0
3: 11
4: 44
Right 1005649462 6:27873388-27873410 ACGCCGTGCCAGGCGTCGGATGG 0: 1
1: 0
2: 1
3: 1
4: 27
1005649454_1005649458 14 Left 1005649454 6:27873341-27873363 CCGCGTGTCTCCTCGTATATAAG 0: 1
1: 0
2: 0
3: 11
4: 44
Right 1005649458 6:27873378-27873400 TAACGCCTCCACGCCGTGCCAGG 0: 1
1: 0
2: 0
3: 0
4: 29
1005649454_1005649460 20 Left 1005649454 6:27873341-27873363 CCGCGTGTCTCCTCGTATATAAG 0: 1
1: 0
2: 0
3: 11
4: 44
Right 1005649460 6:27873384-27873406 CTCCACGCCGTGCCAGGCGTCGG 0: 1
1: 0
2: 0
3: 10
4: 97
1005649454_1005649464 27 Left 1005649454 6:27873341-27873363 CCGCGTGTCTCCTCGTATATAAG 0: 1
1: 0
2: 0
3: 11
4: 44
Right 1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG 0: 1
1: 0
2: 0
3: 5
4: 63
1005649454_1005649465 28 Left 1005649454 6:27873341-27873363 CCGCGTGTCTCCTCGTATATAAG 0: 1
1: 0
2: 0
3: 11
4: 44
Right 1005649465 6:27873392-27873414 CGTGCCAGGCGTCGGATGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005649454 Original CRISPR CTTATATACGAGGAGACACG CGG (reversed) Exonic
908565872 1:65355561-65355583 CTTATGTACTAGGTGGCACGTGG - Intronic
914665974 1:149832832-149832854 CTCATTTACGAGGAGACCCGCGG + Intergenic
914669791 1:149860962-149860984 CTCATTTACGAGGAGACCCGCGG - Exonic
921609067 1:217189429-217189451 TTTATATACGAGAAAACATGTGG + Intergenic
1070168066 10:73912906-73912928 CTTATCTACAAGGGGACAGGAGG - Exonic
1071766602 10:88673059-88673081 TTTATACACGAGGAAACATGAGG - Intronic
1080838329 11:35961155-35961177 CTTCTATACGCTGAGCCACGGGG - Intronic
1084086055 11:66855994-66856016 CTTAAGGACCAGGAGACACGGGG + Intronic
1086315293 11:85585173-85585195 TTTATATACGATGAGAGATGAGG + Intronic
1093077265 12:14770915-14770937 CTCATCTACGAGGAGACCCGGGG - Exonic
1093192281 12:16088708-16088730 CTTATATAGAAGGGGAAACGCGG + Intergenic
1119613259 14:76081608-76081630 ACAACATACGAGGAGACACGAGG - Intronic
1125207502 15:37170935-37170957 CTTATATTAGAGGACACACATGG + Intergenic
1126236982 15:46397373-46397395 CTTATATATGATGAGACATAAGG - Intergenic
1127369666 15:58327077-58327099 CTTATAAACTAGGAGAGACTGGG - Intronic
1127949903 15:63794619-63794641 GTTATATTCCAGGAGACATGAGG + Intronic
1138127897 16:54453971-54453993 CTTACATAGCAGGAGACACTGGG - Intergenic
1139972902 16:70787333-70787355 CTGATATAAGAGGAGAGAGGAGG + Intronic
926647619 2:15306463-15306485 TTTATTTACAAGAAGACACGTGG - Intronic
927514099 2:23661874-23661896 CTTGTATAGGAGGAGACCCTGGG + Intronic
930457808 2:51628741-51628763 CTTATTTACAAGAAGACACTGGG - Intergenic
938621755 2:133062315-133062337 CTTATCTAACAGGAGACACAAGG - Intronic
948462768 2:238138380-238138402 CTTGTAGACGAGGAAACAGGTGG + Intergenic
1169925287 20:10777546-10777568 CTTTTATAGGAGGAGACATTAGG + Intergenic
1184509411 22:44924521-44924543 CTCTTATAAGAAGAGACACGAGG + Intronic
962501037 3:135992821-135992843 CATATATAAGATGAGAAACGGGG + Intronic
971589289 4:28446475-28446497 TTTATATACTTGGAGACAAGTGG + Intergenic
974378914 4:61112623-61112645 CTTAGATATTAGGAGACAGGTGG - Intergenic
982143241 4:152351565-152351587 ATTATATACACGGAAACACGTGG - Intronic
986595573 5:9418274-9418296 CTTTTATAAGAAGAGACACTGGG - Intronic
989139068 5:38184412-38184434 CTTATATGCCAGGATACAAGAGG - Intergenic
998606933 5:143645149-143645171 CTGATATACCAGGAGACACCAGG - Intergenic
998991292 5:147820814-147820836 CTTATATACCAGGAGACAATTGG + Intergenic
1002616659 5:180460476-180460498 CTTAGATTCGAGTACACACGTGG - Intergenic
1005456191 6:26021826-26021848 CTGATCTACGAGGAGACTCGCGG + Exonic
1005464980 6:26104095-26104117 CTTATCTATGAGGAGACTCGAGG + Exonic
1005475621 6:26204792-26204814 CTCATCTACGAGGAGACTCGCGG + Exonic
1005479327 6:26240573-26240595 CTCATTTATGAGGAGACCCGCGG + Exonic
1005484321 6:26285330-26285352 CTTATCTATGAGGAGACTCGTGG - Exonic
1005570364 6:27139456-27139478 CTCATCTATGAGGAGACCCGCGG + Exonic
1005643998 6:27824272-27824294 CTCATCTACGAGGAGACTCGCGG + Exonic
1005645199 6:27831358-27831380 CTCATCTACGAGGAGACTCGCGG - Exonic
1005649454 6:27873341-27873363 CTTATATACGAGGAGACACGCGG - Exonic
1010197721 6:73256706-73256728 ATTATATGAGATGAGACACGTGG - Intronic
1017030168 6:150214131-150214153 CTGATTTAAGAGAAGACACGTGG - Intronic
1033347924 7:140540001-140540023 CTTATGAACGAGGAGACCCAGGG + Intronic
1038252518 8:25918797-25918819 GTTATATACAAGGAGACAAAGGG - Intronic
1047694960 8:127394382-127394404 CTTCTATAGGAGAAGAAACGTGG - Intergenic
1051043785 9:12848864-12848886 CTTATGGAGGAGGAGACACTAGG - Intergenic
1051932875 9:22407710-22407732 CTTATAAACCAGAAGACACTGGG + Intergenic
1051982023 9:23031757-23031779 CTTATATTCTAGGAAACAAGAGG + Intergenic
1061751020 9:132777047-132777069 CTTATCCACCAGGTGACACGCGG - Intronic
1185942379 X:4336093-4336115 TTTATATACTAGGAAACACCTGG - Intergenic
1188674333 X:32920139-32920161 CATATATGCCAGGAGACACCTGG - Intronic
1192068701 X:67914212-67914234 TTTGTATAAGATGAGACACGAGG + Intergenic
1193466218 X:81850882-81850904 TTTATATACGAGGAGAGAGTGGG + Intergenic