ID: 1005649456

View in Genome Browser
Species Human (GRCh38)
Location 6:27873351-27873373
Sequence CATCTCAGGCCTTATATACG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 34}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005649456_1005649460 10 Left 1005649456 6:27873351-27873373 CCTCGTATATAAGGCCTGAGATG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1005649460 6:27873384-27873406 CTCCACGCCGTGCCAGGCGTCGG 0: 1
1: 0
2: 0
3: 10
4: 97
1005649456_1005649465 18 Left 1005649456 6:27873351-27873373 CCTCGTATATAAGGCCTGAGATG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1005649465 6:27873392-27873414 CGTGCCAGGCGTCGGATGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 43
1005649456_1005649464 17 Left 1005649456 6:27873351-27873373 CCTCGTATATAAGGCCTGAGATG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG 0: 1
1: 0
2: 0
3: 5
4: 63
1005649456_1005649462 14 Left 1005649456 6:27873351-27873373 CCTCGTATATAAGGCCTGAGATG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1005649462 6:27873388-27873410 ACGCCGTGCCAGGCGTCGGATGG 0: 1
1: 0
2: 1
3: 1
4: 27
1005649456_1005649458 4 Left 1005649456 6:27873351-27873373 CCTCGTATATAAGGCCTGAGATG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1005649458 6:27873378-27873400 TAACGCCTCCACGCCGTGCCAGG 0: 1
1: 0
2: 0
3: 0
4: 29
1005649456_1005649467 23 Left 1005649456 6:27873351-27873373 CCTCGTATATAAGGCCTGAGATG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1005649467 6:27873397-27873419 CAGGCGTCGGATGGCGGGCTTGG 0: 1
1: 0
2: 1
3: 9
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005649456 Original CRISPR CATCTCAGGCCTTATATACG AGG (reversed) Exonic
904446473 1:30576925-30576947 CAAGTCAGGCCTTATATACTGGG + Intergenic
909623264 1:77688472-77688494 CATCTTAGATTTTATATACGTGG - Intergenic
914665972 1:149832822-149832844 GATCTCTGGCCTCATTTACGAGG + Intergenic
914669793 1:149860972-149860994 GATCTCTGGCCTCATTTACGAGG - Exonic
915203402 1:154251005-154251027 CATCTCTGGCTTCATATACTGGG + Intronic
920688919 1:208131014-208131036 CCTCTCAGGCCTTTTATCCAGGG - Intronic
922999741 1:229997080-229997102 CGTCTCAGGCCTCTTTTACGAGG + Intergenic
1065022384 10:21510623-21510645 CATCTCAGGCCTTTTAAAGTAGG + Intergenic
1072398244 10:95067860-95067882 CATCACAGGCCATCTATAAGTGG - Intronic
1076604412 10:131680111-131680133 CATCAGAGGCCTTTTATAGGTGG - Intergenic
1090224249 11:125059888-125059910 CATCCCAGCCCTTATATAACTGG - Intergenic
1127035466 15:54911927-54911949 CATCTCAGGCTTGATATATTTGG - Intergenic
1157397495 18:47355084-47355106 CATTTCAGGCCTCATATCTGGGG - Intergenic
1158465190 18:57683997-57684019 CATCTCAGGCATTAGAGACCAGG - Intronic
1164134986 19:22406330-22406352 CACTTCAGGCCCTATTTACGTGG - Intronic
1167423103 19:49415259-49415281 CACCGCAGGCCTCATAGACGTGG + Intronic
928114569 2:28537894-28537916 CATCTGGGGCCTTAAATACAGGG + Intronic
932930726 2:76034718-76034740 CATCTCATGCCTTATGTTCAAGG - Intergenic
937618788 2:123960902-123960924 CATCTCAGGTCTTATGTATATGG + Intergenic
945968559 2:216213964-216213986 CATCTCAGGCCTTCTCAAAGGGG + Intergenic
1169496268 20:6118598-6118620 CATCTAAGGCCTTAAATAGAAGG + Intronic
1185027480 22:48424012-48424034 CTTCTCAGGCCTTTTATGGGAGG - Intergenic
954856384 3:53647361-53647383 CTGCTCAGGCCTTTTATACCAGG + Intronic
973723077 4:53744814-53744836 CATCTCCTGCCTTATATGGGAGG - Intronic
974689326 4:65275012-65275034 CATCATAGGCCTTATATGCCAGG + Intergenic
990528721 5:56653520-56653542 CATCTTAGGCATCATATGCGGGG - Intergenic
993335384 5:86651463-86651485 CATCCCATGCCACATATACGTGG + Intergenic
998668824 5:144330437-144330459 CATCTAAGGCTTTATTTACTGGG + Intronic
1003780044 6:9414866-9414888 TATCTTAGGCCTTACAGACGTGG + Intergenic
1005643995 6:27824262-27824284 CATCTCCGGCCTCATCTACGAGG + Exonic
1005645202 6:27831368-27831390 CATCTCCGGCCTCATCTACGAGG - Exonic
1005649456 6:27873351-27873373 CATCTCAGGCCTTATATACGAGG - Exonic
1015866354 6:137730721-137730743 CATCTCAGCCCTAATAGAGGAGG + Intergenic
1043302198 8:78747483-78747505 CATCTGAAGCCTTATTTAGGGGG + Intronic
1185556908 X:1028825-1028847 CATGTCAGGCCTTACATAATCGG - Intergenic
1192798692 X:74445872-74445894 CTTCTCAGGCCTTATTTGCAAGG + Intronic
1197306705 X:124851286-124851308 TATCTCAGTCCTTATTTACAGGG + Intronic
1197425447 X:126291485-126291507 CACCTCAGGCCTTCTATAGTAGG + Intergenic