ID: 1005649457

View in Genome Browser
Species Human (GRCh38)
Location 6:27873365-27873387
Sequence GGAGGCGTTAAGCGCATCTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 4, 3: 5, 4: 38}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005649457_1005649458 -10 Left 1005649457 6:27873365-27873387 CCTGAGATGCGCTTAACGCCTCC 0: 1
1: 0
2: 4
3: 5
4: 38
Right 1005649458 6:27873378-27873400 TAACGCCTCCACGCCGTGCCAGG 0: 1
1: 0
2: 0
3: 0
4: 29
1005649457_1005649460 -4 Left 1005649457 6:27873365-27873387 CCTGAGATGCGCTTAACGCCTCC 0: 1
1: 0
2: 4
3: 5
4: 38
Right 1005649460 6:27873384-27873406 CTCCACGCCGTGCCAGGCGTCGG 0: 1
1: 0
2: 0
3: 10
4: 97
1005649457_1005649467 9 Left 1005649457 6:27873365-27873387 CCTGAGATGCGCTTAACGCCTCC 0: 1
1: 0
2: 4
3: 5
4: 38
Right 1005649467 6:27873397-27873419 CAGGCGTCGGATGGCGGGCTTGG 0: 1
1: 0
2: 1
3: 9
4: 90
1005649457_1005649464 3 Left 1005649457 6:27873365-27873387 CCTGAGATGCGCTTAACGCCTCC 0: 1
1: 0
2: 4
3: 5
4: 38
Right 1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG 0: 1
1: 0
2: 0
3: 5
4: 63
1005649457_1005649465 4 Left 1005649457 6:27873365-27873387 CCTGAGATGCGCTTAACGCCTCC 0: 1
1: 0
2: 4
3: 5
4: 38
Right 1005649465 6:27873392-27873414 CGTGCCAGGCGTCGGATGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 43
1005649457_1005649462 0 Left 1005649457 6:27873365-27873387 CCTGAGATGCGCTTAACGCCTCC 0: 1
1: 0
2: 4
3: 5
4: 38
Right 1005649462 6:27873388-27873410 ACGCCGTGCCAGGCGTCGGATGG 0: 1
1: 0
2: 1
3: 1
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005649457 Original CRISPR GGAGGCGTTAAGCGCATCTC AGG (reversed) Exonic
914665971 1:149832808-149832830 GGCGGCGTTAAGCGGATCTCTGG + Intergenic
914669794 1:149860986-149861008 GGCGGCGTTAAGCGGATCTCTGG - Exonic
916167539 1:161977341-161977363 GGAGACTTTAAGCACCTCTCAGG + Intergenic
917496212 1:175542345-175542367 GGAGGCATTTAGCCCACCTCGGG + Intronic
920516306 1:206586942-206586964 GGAGGCCTTAAGAGAATCCCAGG + Exonic
1075106497 10:119543008-119543030 GGAGGCGGTTAGCGCGTCCCGGG + Intergenic
1078617701 11:12880797-12880819 GGAGGCGCTAAGGGGAGCTCTGG + Intronic
1083925527 11:65803858-65803880 GGAGGAGTTCAGGGCATGTCGGG - Intergenic
1088738873 11:112750752-112750774 GGAGGCGTCAATCTCATCTCTGG - Intergenic
1091786830 12:3248041-3248063 GGAGAGGTTGAGCACATCTCTGG - Intronic
1093077269 12:14770939-14770961 GGGGGCGTCAAGCGCATTTCTGG - Exonic
1103503609 12:121424980-121425002 GGAAGGGTTAAGAGCAACTCTGG - Intronic
1104676151 12:130713884-130713906 GGAGGCGCTTTACGCATCTCTGG - Intronic
1112567173 13:100561703-100561725 GGAGGTGTGAAGGGCATCCCGGG - Intronic
1117501453 14:56356745-56356767 GGAGGAGTTAAGAACATCACTGG + Intergenic
1122878642 14:104680079-104680101 GGAGGCTTTGAGTGCAGCTCGGG - Intergenic
1125390118 15:39183730-39183752 GAAGGGGTTAAGAGCAGCTCTGG - Intergenic
1135165188 16:20132944-20132966 GGAGAGGTTAAGCACATCACGGG + Intergenic
1140057468 16:71537648-71537670 GGAGACATTAAGGGCATCCCTGG - Exonic
1140506828 16:75478839-75478861 GGAGACGTTGAGCGCATTCCTGG + Exonic
1140866561 16:79067457-79067479 GGAGCCGAGAAGAGCATCTCAGG - Intronic
1142250503 16:88989699-88989721 GGAGGCCTTGAGGGCATCTGAGG + Intergenic
1143823690 17:9586644-9586666 GGAGGCATTAAAAGCATCTGAGG - Intronic
931294494 2:60908036-60908058 GAAGGCTTTCAGGGCATCTCAGG - Intronic
1169444430 20:5659632-5659654 GCAGGCTTTGAGGGCATCTCAGG - Intergenic
1179550932 21:42143325-42143347 GGAGGCCAGAAACGCATCTCTGG + Intronic
1184190166 22:42889224-42889246 GGAGGGGTTATGGGCATCCCAGG + Intronic
1184998326 22:48226684-48226706 GCAGGCGTTAAGCTCAGCACCGG + Intergenic
977803491 4:101267583-101267605 GGAGGGGATAAGCGGATCTGAGG + Intronic
979699046 4:123646645-123646667 GCAGTCGTTAAGTGCATCTTGGG + Intergenic
990343578 5:54849343-54849365 GGAGGCATTAAGTGCATCCTAGG + Intergenic
992249725 5:74865677-74865699 GAAGGCGGTCAGAGCATCTCTGG + Intronic
992743323 5:79795415-79795437 GGAGGCGTGAAGATCATCTCAGG + Intronic
1002536666 5:179879684-179879706 GGAGGCGCCAACCGCATCCCAGG - Exonic
1005456189 6:26021802-26021824 GGCGGTGTGAAGCGGATCTCTGG + Exonic
1005456722 6:26027107-26027129 GGTGGGGTTAAGCGAATTTCCGG - Exonic
1005464977 6:26104071-26104093 GGTGGCGTCAAGCGCATTTCCGG + Exonic
1005473922 6:26188931-26188953 GGCGGCGTCAAGCGTATTTCTGG - Exonic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1005479324 6:26240549-26240571 GGCGGCGTGAAACGCATTTCGGG + Exonic
1005480012 6:26246832-26246854 GGCGGTGTCAAGCGCATCTTGGG - Exonic
1005570361 6:27139432-27139454 GGCGGCGTGAAGCGCATTTCTGG + Exonic
1005643994 6:27824248-27824270 GGCGGCGTGAAGCGCATCTCCGG + Exonic
1005645203 6:27831382-27831404 GGCGGCGTGAAGCGCATCTCCGG - Exonic
1005649457 6:27873365-27873387 GGAGGCGTTAAGCGCATCTCAGG - Exonic
1056346756 9:85704297-85704319 GGAGGCTTTCTGCACATCTCTGG - Intronic
1060973922 9:127754167-127754189 GGAGGCGGTGAGATCATCTCTGG - Intronic
1189198013 X:39167877-39167899 TGAGGCATTTAGCTCATCTCTGG + Intergenic