ID: 1005649457

View in Genome Browser
Species Human (GRCh38)
Location 6:27873365-27873387
Sequence GGAGGCGTTAAGCGCATCTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 4, 3: 5, 4: 38}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005649457_1005649462 0 Left 1005649457 6:27873365-27873387 CCTGAGATGCGCTTAACGCCTCC 0: 1
1: 0
2: 4
3: 5
4: 38
Right 1005649462 6:27873388-27873410 ACGCCGTGCCAGGCGTCGGATGG 0: 1
1: 0
2: 1
3: 1
4: 27
1005649457_1005649458 -10 Left 1005649457 6:27873365-27873387 CCTGAGATGCGCTTAACGCCTCC 0: 1
1: 0
2: 4
3: 5
4: 38
Right 1005649458 6:27873378-27873400 TAACGCCTCCACGCCGTGCCAGG 0: 1
1: 0
2: 0
3: 0
4: 29
1005649457_1005649464 3 Left 1005649457 6:27873365-27873387 CCTGAGATGCGCTTAACGCCTCC 0: 1
1: 0
2: 4
3: 5
4: 38
Right 1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG 0: 1
1: 0
2: 0
3: 5
4: 63
1005649457_1005649460 -4 Left 1005649457 6:27873365-27873387 CCTGAGATGCGCTTAACGCCTCC 0: 1
1: 0
2: 4
3: 5
4: 38
Right 1005649460 6:27873384-27873406 CTCCACGCCGTGCCAGGCGTCGG 0: 1
1: 0
2: 0
3: 10
4: 97
1005649457_1005649465 4 Left 1005649457 6:27873365-27873387 CCTGAGATGCGCTTAACGCCTCC 0: 1
1: 0
2: 4
3: 5
4: 38
Right 1005649465 6:27873392-27873414 CGTGCCAGGCGTCGGATGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 43
1005649457_1005649467 9 Left 1005649457 6:27873365-27873387 CCTGAGATGCGCTTAACGCCTCC 0: 1
1: 0
2: 4
3: 5
4: 38
Right 1005649467 6:27873397-27873419 CAGGCGTCGGATGGCGGGCTTGG 0: 1
1: 0
2: 1
3: 9
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005649457 Original CRISPR GGAGGCGTTAAGCGCATCTC AGG (reversed) Exonic