ID: 1005649458

View in Genome Browser
Species Human (GRCh38)
Location 6:27873378-27873400
Sequence TAACGCCTCCACGCCGTGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 29}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005649456_1005649458 4 Left 1005649456 6:27873351-27873373 CCTCGTATATAAGGCCTGAGATG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1005649458 6:27873378-27873400 TAACGCCTCCACGCCGTGCCAGG 0: 1
1: 0
2: 0
3: 0
4: 29
1005649457_1005649458 -10 Left 1005649457 6:27873365-27873387 CCTGAGATGCGCTTAACGCCTCC 0: 1
1: 0
2: 4
3: 5
4: 38
Right 1005649458 6:27873378-27873400 TAACGCCTCCACGCCGTGCCAGG 0: 1
1: 0
2: 0
3: 0
4: 29
1005649454_1005649458 14 Left 1005649454 6:27873341-27873363 CCGCGTGTCTCCTCGTATATAAG 0: 1
1: 0
2: 0
3: 11
4: 44
Right 1005649458 6:27873378-27873400 TAACGCCTCCACGCCGTGCCAGG 0: 1
1: 0
2: 0
3: 0
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005649458 Original CRISPR TAACGCCTCCACGCCGTGCC AGG Exonic
903785592 1:25859224-25859246 TTACGCCTCCAGGCCCTACCTGG + Intronic
924854807 1:247865581-247865603 TAATCCCTCCTCGCCATGCCTGG - Intronic
1072491174 10:95907557-95907579 TCGCGCCTCCACGCCCTGCGCGG + Intronic
1077231853 11:1461293-1461315 CACCGCCTCCACGCCGCACCTGG + Exonic
1090645901 11:128766601-128766623 TCAGGCCTCCCCGCCCTGCCTGG + Intronic
1091887344 12:4026174-4026196 TAAAGCATTGACGCCGTGCCAGG - Intergenic
1092429378 12:8396830-8396852 CACCGCCACCACGCCGGGCCCGG + Intergenic
1121713397 14:96055707-96055729 TGAAGCCTCCTCACCGTGCCTGG + Intronic
1128103941 15:65029348-65029370 GAAGGCCTCCAGGCCGCGCCCGG - Intronic
1162954188 19:14089485-14089507 TTACGCATTCACTCCGTGCCAGG + Intronic
1166227556 19:41406063-41406085 AAAGGGCTCCACGCTGTGCCTGG - Intronic
1168210844 19:54888918-54888940 TCACGCCACCACGCCCGGCCAGG - Intronic
929578736 2:43068673-43068695 TACCGGCTCCACGCCCAGCCTGG + Intergenic
932413294 2:71559699-71559721 TAACGCCTGCTGGCCCTGCCAGG + Intronic
936018657 2:108978249-108978271 AAACACTTCCACGCCCTGCCTGG - Intronic
1184554732 22:45227038-45227060 TCACTCCTCCACTCCCTGCCCGG + Intronic
995805380 5:116046550-116046572 TGAGGCCTCCACACCTTGCCAGG + Intronic
1003311147 6:4970960-4970982 TGACCCCTCCTCGCTGTGCCTGG - Intergenic
1005385325 6:25279550-25279572 TGACGCCTCCTCGCAGTTCCCGG - Exonic
1005583210 6:27252051-27252073 TAACTCCTCCCAGCTGTGCCAGG - Intronic
1005649458 6:27873378-27873400 TAACGCCTCCACGCCGTGCCAGG + Exonic
1019471731 7:1224758-1224780 TGACCCCTCCACTCCGTGCAGGG + Intergenic
1024261823 7:47579243-47579265 TAACCCCTGCAAGCTGTGCCTGG - Intronic
1034670238 7:152852261-152852283 AGAGGCCTCCACGCAGTGCCTGG + Intronic
1037784487 8:21894540-21894562 TAACGCCTCCATGAAATGCCAGG - Intergenic
1037784554 8:21894913-21894935 TAACGCCTCCATGAAATGCCAGG + Intergenic
1042211931 8:66389725-66389747 TAATGCCTCCACGCTGGGCGCGG + Intergenic
1056291363 9:85147228-85147250 TAATGCCTACACCCAGTGCCTGG - Intergenic
1059665858 9:116446036-116446058 TAACCCCTCCAGGCACTGCCTGG - Intronic
1062236306 9:135510155-135510177 TAACTCCTCCTGGCCGGGCCTGG - Intergenic