ID: 1005649460

View in Genome Browser
Species Human (GRCh38)
Location 6:27873384-27873406
Sequence CTCCACGCCGTGCCAGGCGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005649454_1005649460 20 Left 1005649454 6:27873341-27873363 CCGCGTGTCTCCTCGTATATAAG 0: 1
1: 0
2: 0
3: 11
4: 44
Right 1005649460 6:27873384-27873406 CTCCACGCCGTGCCAGGCGTCGG 0: 1
1: 0
2: 0
3: 10
4: 97
1005649457_1005649460 -4 Left 1005649457 6:27873365-27873387 CCTGAGATGCGCTTAACGCCTCC 0: 1
1: 0
2: 4
3: 5
4: 38
Right 1005649460 6:27873384-27873406 CTCCACGCCGTGCCAGGCGTCGG 0: 1
1: 0
2: 0
3: 10
4: 97
1005649456_1005649460 10 Left 1005649456 6:27873351-27873373 CCTCGTATATAAGGCCTGAGATG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1005649460 6:27873384-27873406 CTCCACGCCGTGCCAGGCGTCGG 0: 1
1: 0
2: 0
3: 10
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005649460 Original CRISPR CTCCACGCCGTGCCAGGCGT CGG Exonic
902669522 1:17963159-17963181 GTCCACTCTGTGCCAGGCTTTGG - Intergenic
902916631 1:19643921-19643943 CGTCAGGCCGTGCCAGGCCTCGG - Intronic
906955895 1:50373345-50373367 CTCCACTTCATGCCAGGCCTGGG + Intergenic
919471714 1:197987477-197987499 CCCCACGCCCTGCCAAGTGTAGG + Intergenic
921100292 1:211922880-211922902 CTCCACTCCCTCCCAGGGGTAGG + Intergenic
1063129729 10:3167932-3167954 TTCCACGCCGCCCCAGGAGTGGG - Intronic
1063979352 10:11441252-11441274 CTGCACGCGGTGCCAGGTGATGG + Intergenic
1066464748 10:35641810-35641832 CTCCCCGCCGCGCCGGGCGGCGG + Exonic
1070781356 10:79139266-79139288 CTCTGCGCCGTGCCTGGCTTCGG - Intronic
1072537002 10:96371517-96371539 CTCCACGCCCTGCCTGGCCCCGG + Intronic
1080961486 11:37165974-37165996 CTCTACTCCATGCCAGGCATTGG - Intergenic
1081804924 11:45885449-45885471 CTCCACCCCGTGGCCGGTGTGGG - Intergenic
1084043888 11:66558034-66558056 CTCCAGCCCCCGCCAGGCGTTGG - Exonic
1085305674 11:75484396-75484418 CTCCACTCCTACCCAGGCGTGGG + Intronic
1090645945 11:128766746-128766768 CTCCATCCCCTGCCAGGCGCAGG - Intronic
1096777803 12:53974563-53974585 CTCCACTGCGTTCCAGGCGGGGG + Intronic
1103791825 12:123477616-123477638 CACCACGCCTGGCCAGGAGTTGG + Intronic
1103861231 12:124015953-124015975 CTTCACGCCTTCCCAGGCATGGG - Intronic
1104014192 12:124951305-124951327 ATCCACGCCATGGCAGGTGTCGG - Intronic
1104653474 12:130555934-130555956 CTCCTCTCCGTGCCTGGCGATGG - Intronic
1109744974 13:66613154-66613176 TTCCACTCCCTGCCAGGCCTGGG + Intronic
1111529019 13:89511937-89511959 CCCCACCCCGTGACAGGCCTTGG - Intergenic
1120680270 14:87472326-87472348 CTCCACGCCCTTCCAGGCATGGG + Intergenic
1124201912 15:27686052-27686074 CTCCACTGCGTGCCAGTCTTAGG - Intergenic
1124202199 15:27687996-27688018 CACCACGACATGCCAGGTGTGGG - Intergenic
1125955363 15:43787285-43787307 CACCACGCCCGGCCAGGCCTGGG + Intronic
1131160501 15:90102083-90102105 TTCCCGGCCGTGCCAGGCGCTGG - Intronic
1132467792 16:85534-85556 CTCCAAGCTGTGCCAGGCCCTGG + Exonic
1134214643 16:12307669-12307691 CTCCACGCCATTCCAGGCTTCGG - Intronic
1135052410 16:19203716-19203738 CTCCACCCTGTGCCAGGCAAAGG - Intronic
1137674798 16:50298980-50299002 CTTCACGCAGTTCCGGGCGTGGG - Exonic
1138163973 16:54782628-54782650 CTCCACCCCGTGACAGGCTCCGG + Intergenic
1139946852 16:70647695-70647717 CTCAACCCTGTGCCAGGCGTTGG - Intronic
1141608566 16:85169190-85169212 CCCCACGCCTTGGCAGGCGCCGG + Intergenic
1141741965 16:85899283-85899305 CCCCACGCCCCGCCTGGCGTCGG - Intronic
1142132509 16:88437408-88437430 CTCCCCGCCGGCCCAGGGGTCGG - Exonic
1142245602 16:88968795-88968817 CACCCCTCCGTGCCAGGCGCAGG - Intronic
1142757281 17:2023907-2023929 CTCCTGGCCGGGCCAGGCGCGGG + Intronic
1144481853 17:15636263-15636285 CCCCACCCCCTGCCAGGTGTCGG - Exonic
1144699849 17:17330010-17330032 CACCACGCCCAGCCAGGAGTAGG - Intronic
1148073098 17:44920050-44920072 CACCACGCTGTGCCAGGCACTGG - Intergenic
1150226854 17:63529121-63529143 CACCACGCCCGGCCAGGCATGGG + Intronic
1151699671 17:75736597-75736619 CTGCGTGCAGTGCCAGGCGTGGG + Exonic
1152751719 17:82065442-82065464 CTCCGCGCCGGGCCAGGGGAAGG + Exonic
1152762009 17:82113642-82113664 CTCCACGCCAGGCTGGGCGTGGG + Intronic
1159845244 18:73451246-73451268 CTCCACCCCGTGACAGGCCCTGG + Intergenic
1161288990 19:3482930-3482952 CTCCTCGCCCTGCCAGGCCAGGG + Intergenic
1161634406 19:5378188-5378210 CTCTAAGCTGTCCCAGGCGTGGG + Intergenic
1161895236 19:7074934-7074956 CTCCAGCCCGTGCCCTGCGTCGG - Intronic
1162344953 19:10113543-10113565 ATCCACGCCATGGCAGACGTGGG + Intronic
1162454843 19:10777169-10777191 CTCCAAGACGTCCCTGGCGTCGG - Exonic
1165062286 19:33210766-33210788 CTCCACGCCCTGCCTGGCCCAGG + Intronic
1166003058 19:39889703-39889725 CTCTACCACCTGCCAGGCGTCGG - Exonic
1166005845 19:39905955-39905977 CTCTACCACCTGCCAGGCGTCGG - Exonic
1166327785 19:42061867-42061889 CCCCTCGCCCTGCCCGGCGTGGG + Intronic
1166748329 19:45152474-45152496 CCCCACGCCGCGCCAGGCGGTGG - Exonic
1167158291 19:47752410-47752432 CTCCAGGCCTTGCCAGTGGTTGG - Intronic
1167808730 19:51809851-51809873 CTCAACCCCGTTCCAGGCATGGG - Intronic
937610175 2:123851813-123851835 CTCCACTCCTTCCCTGGCGTGGG + Intergenic
948692725 2:239717039-239717061 CTCCAGGCCATCCCAGGCTTTGG + Intergenic
1175331662 20:58168770-58168792 CTACACCTCTTGCCAGGCGTGGG + Intergenic
1178620048 21:34166476-34166498 CTCCCCGCCCTGCCAGGGCTGGG - Intergenic
1179382032 21:40908682-40908704 CTCCAAGCCATGCTAAGCGTGGG + Intergenic
1179781050 21:43701263-43701285 ATCCAGGCAGTGCCAGGCGCTGG + Intergenic
1179919549 21:44500059-44500081 CCCCACGCTGTGCCAGTCGGGGG - Intronic
1181541144 22:23573960-23573982 CTCCAGGCCATGCCAGGCTTGGG - Intronic
1181551045 22:23639317-23639339 CTCCAGGCCATGCCAGGCTTGGG - Intergenic
1181797234 22:25319370-25319392 CTCCAGGCCATGCCAGGCTTGGG + Intergenic
1184347437 22:43922424-43922446 CTCCACCCAGTGCCAGGGGTAGG + Intergenic
1184791859 22:46705061-46705083 CTCCAGGCTGTGCCAGGCTTGGG + Intronic
1185142214 22:49108845-49108867 CGCCACGCCTTGCCATGCCTGGG - Intergenic
956420345 3:69080379-69080401 CTCCCCGCCCTGCCGCGCGTGGG - Exonic
957161075 3:76610399-76610421 CCCCACGCCGTTCCAGCTGTGGG - Intronic
968512785 4:1002834-1002856 CACCGCGGCGCGCCAGGCGTCGG - Exonic
969973263 4:11070245-11070267 CTTCACCCCTTGCCAGGCGGTGG + Intergenic
971256455 4:25018436-25018458 CTCCACGCCATGCCAGAAATGGG + Intronic
974270607 4:59646605-59646627 CACCACGCCCTGCCAGTCTTCGG + Intergenic
977120613 4:93095279-93095301 CTCCACGCCCTGACAGGCCCCGG + Intronic
987830711 5:23091058-23091080 CTCCACCCCCTGACAGGCCTTGG - Intergenic
988482145 5:31639563-31639585 CTCCCCGCCCTGCCAGGGCTGGG - Intronic
1005456184 6:26021783-26021805 CGCCACGCCGGGCCAGACGCCGG - Exonic
1005579288 6:27218116-27218138 CTCCACGATGCCCCAGGCGTCGG - Intergenic
1005649460 6:27873384-27873406 CTCCACGCCGTGCCAGGCGTCGG + Exonic
1015548485 6:134386837-134386859 CTCCACCCCGTGACAGGCCCTGG - Intergenic
1019216731 6:170448577-170448599 CCCCAGGCCCTGGCAGGCGTGGG + Intergenic
1019329458 7:455469-455491 CTCCTCCCTGTGCCAGGCCTGGG + Intergenic
1019471738 7:1224764-1224786 CTCCACTCCGTGCAGGGGGTGGG + Intergenic
1025947438 7:66115171-66115193 CTCCACGCCGTGTCTGGTGCGGG + Intronic
1032222029 7:130001602-130001624 CACCACGCCTAGCCAGGGGTTGG - Intergenic
1032401105 7:131624998-131625020 CACCACGCCTTGCCAGAAGTAGG - Intergenic
1032752820 7:134858854-134858876 CACCACGCCCAGCCAGGAGTTGG + Intronic
1034553312 7:151834701-151834723 CTCCACTCCGTTCCTGGGGTGGG - Intronic
1034695275 7:153047946-153047968 CTACACGCAGGGCCAGGCCTGGG - Intergenic
1039969234 8:42307433-42307455 CTCCACACAGTGTCAGGAGTGGG - Intronic
1040817156 8:51520423-51520445 CTCCACGCCGCACCAGGAGGAGG + Intronic
1045571281 8:103371435-103371457 CCCCACCCCGAGCCCGGCGTGGG - Intergenic
1047381756 8:124371695-124371717 CCCCCAGCCGTCCCAGGCGTGGG + Intronic
1049380123 8:142308536-142308558 CTCCACCCTGTCCCATGCGTTGG + Intronic
1049387989 8:142353885-142353907 CTCCACCCAGTGCCAGGCCTCGG - Intronic
1049397197 8:142406458-142406480 CTCCAGGCTGTTCCAGGTGTGGG - Intergenic
1054468205 9:65512582-65512604 CTTGAAGCCTTGCCAGGCGTAGG + Intergenic
1061700237 9:132410200-132410222 CTCCAGGCTGTGCCCGACGTGGG + Intronic
1062059683 9:134488406-134488428 CGCCACGCTGTGCCAGGCCAGGG - Intergenic
1062529407 9:136993297-136993319 CCCCACTCAGTGCCAGGAGTGGG - Intronic
1186469199 X:9808015-9808037 CTCCCTGCGGTGCCAGGCCTGGG - Intronic
1191907407 X:66108101-66108123 CCCCACCCCGGGCCAGGCATGGG + Intergenic
1200208221 X:154332889-154332911 CTCCTCGCCCTGCCAGGCCGAGG + Intergenic
1200960515 Y:8991900-8991922 CTCCATCCCCTGCCAGGCATTGG + Intergenic