ID: 1005649462

View in Genome Browser
Species Human (GRCh38)
Location 6:27873388-27873410
Sequence ACGCCGTGCCAGGCGTCGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 27}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005649457_1005649462 0 Left 1005649457 6:27873365-27873387 CCTGAGATGCGCTTAACGCCTCC 0: 1
1: 0
2: 4
3: 5
4: 38
Right 1005649462 6:27873388-27873410 ACGCCGTGCCAGGCGTCGGATGG 0: 1
1: 0
2: 1
3: 1
4: 27
1005649454_1005649462 24 Left 1005649454 6:27873341-27873363 CCGCGTGTCTCCTCGTATATAAG 0: 1
1: 0
2: 0
3: 11
4: 44
Right 1005649462 6:27873388-27873410 ACGCCGTGCCAGGCGTCGGATGG 0: 1
1: 0
2: 1
3: 1
4: 27
1005649456_1005649462 14 Left 1005649456 6:27873351-27873373 CCTCGTATATAAGGCCTGAGATG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1005649462 6:27873388-27873410 ACGCCGTGCCAGGCGTCGGATGG 0: 1
1: 0
2: 1
3: 1
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005649462 Original CRISPR ACGCCGTGCCAGGCGTCGGA TGG Exonic
920263335 1:204704346-204704368 CAGCCGTGCCAGGGGGCGGACGG - Intergenic
924461392 1:244262850-244262872 ACGCCCAGCCAGGCATGGGAAGG - Intergenic
1063691983 10:8296106-8296128 CCTCCGTGCCTGGCCTCGGAAGG - Intergenic
1110558348 13:76885541-76885563 ACGCCGTCCCAGTCGCTGGACGG - Exonic
1111045688 13:82811036-82811058 AAGGCCTGCCAGGGGTCGGAGGG + Intergenic
1132016358 15:98320816-98320838 CCCCCGTGCCAGGCGTGGGGAGG + Intergenic
1139105247 16:63820017-63820039 CCTCCGAGCCAGGCGTGGGAGGG - Intergenic
1141280477 16:82626588-82626610 AAGCCTTGCCAGGCGTAGAAAGG + Intergenic
1147315351 17:39617776-39617798 GCGCCGTGCCAGGCGCGGGGCGG - Intergenic
1162349599 19:10140653-10140675 CCACCGTGCCTGGCCTCGGAAGG + Intronic
929777922 2:44939884-44939906 CCGCAGTGCCAGGCCTCTGAGGG - Intergenic
1175414336 20:58791950-58791972 AGGCCGTCCCAGGCCTCGCATGG + Intergenic
1176011301 20:62897810-62897832 ACGGCGTGCCAGGGGACAGATGG + Intronic
1179511278 21:41875319-41875341 TCGCCCTGCCAGGCCCCGGACGG + Intronic
962023635 3:131525998-131526020 CCACCGTGCCAGGCCTAGGAGGG + Intergenic
963213927 3:142724211-142724233 GGGCCGTGCCAGGAGTCGCAGGG - Exonic
968512783 4:1002830-1002852 GCGGCGCGCCAGGCGTCGGCCGG - Exonic
978954645 4:114598990-114599012 ACGCCGTTCCAGAGGGCGGAAGG + Intronic
984908098 4:184648892-184648914 AGGCCGGGTCAGGCGGCGGAAGG - Intronic
986233550 5:5887154-5887176 GCGCTGTGCCAGGGGTGGGAAGG + Intergenic
990954667 5:61331006-61331028 ACGGCGTGCCAGGCGGCGGACGG - Intergenic
1004912478 6:20300302-20300324 CCACCGTGCCAGGCGTCTTATGG - Intergenic
1005456182 6:26021779-26021801 ACGCCGGGCCAGACGCCGGATGG - Exonic
1005649462 6:27873388-27873410 ACGCCGTGCCAGGCGTCGGATGG + Exonic
1011745267 6:90402497-90402519 ACGCCGTGCCAGGAGCTTGATGG - Intergenic
1013436631 6:110116379-110116401 CCGCCGAGCCAGGCATGGGAGGG - Intronic
1013793684 6:113860424-113860446 GCGCCGGGCCCGGCGGCGGAGGG - Exonic
1019273425 7:163466-163488 AGCCCGTGGCAGGCGTGGGATGG + Intergenic
1028236959 7:88373701-88373723 CCGCCGAGCCAGGCATGGGAGGG + Intergenic
1035242402 7:157540828-157540850 ACGCTGTGGCAGGAGTCGGGGGG - Intronic