ID: 1005649464

View in Genome Browser
Species Human (GRCh38)
Location 6:27873391-27873413
Sequence CCGTGCCAGGCGTCGGATGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 63}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005649456_1005649464 17 Left 1005649456 6:27873351-27873373 CCTCGTATATAAGGCCTGAGATG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG 0: 1
1: 0
2: 0
3: 5
4: 63
1005649457_1005649464 3 Left 1005649457 6:27873365-27873387 CCTGAGATGCGCTTAACGCCTCC 0: 1
1: 0
2: 4
3: 5
4: 38
Right 1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG 0: 1
1: 0
2: 0
3: 5
4: 63
1005649454_1005649464 27 Left 1005649454 6:27873341-27873363 CCGCGTGTCTCCTCGTATATAAG 0: 1
1: 0
2: 0
3: 11
4: 44
Right 1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG 0: 1
1: 0
2: 0
3: 5
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005649464 Original CRISPR CCGTGCCAGGCGTCGGATGG CGG Exonic