ID: 1005649464

View in Genome Browser
Species Human (GRCh38)
Location 6:27873391-27873413
Sequence CCGTGCCAGGCGTCGGATGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 63}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005649454_1005649464 27 Left 1005649454 6:27873341-27873363 CCGCGTGTCTCCTCGTATATAAG 0: 1
1: 0
2: 0
3: 11
4: 44
Right 1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG 0: 1
1: 0
2: 0
3: 5
4: 63
1005649456_1005649464 17 Left 1005649456 6:27873351-27873373 CCTCGTATATAAGGCCTGAGATG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG 0: 1
1: 0
2: 0
3: 5
4: 63
1005649457_1005649464 3 Left 1005649457 6:27873365-27873387 CCTGAGATGCGCTTAACGCCTCC 0: 1
1: 0
2: 4
3: 5
4: 38
Right 1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG 0: 1
1: 0
2: 0
3: 5
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005649464 Original CRISPR CCGTGCCAGGCGTCGGATGG CGG Exonic
901501662 1:9656135-9656157 CGGTGCCAGGAGTAGGGTGGGGG + Intronic
902719006 1:18291857-18291879 CTGTGGCAGGTGACGGATGGTGG + Exonic
902824757 1:18965398-18965420 GAGTGCCAGGCATCAGATGGAGG + Intergenic
907185026 1:52602719-52602741 CCGGGCCGGGCGCGGGATGGGGG - Intronic
912174834 1:107141758-107141780 CCCTGTCAGTCGGCGGATGGAGG - Intronic
918127634 1:181598225-181598247 CCGTGTTAGGCATTGGATGGTGG + Intronic
919325804 1:196105322-196105344 CGGGGCCAGTCGTGGGATGGGGG + Intergenic
920805720 1:209231858-209231880 CCGTGCCCCGCGCCGGATTGGGG + Intergenic
1067339142 10:45387053-45387075 GCGTGCCAGGCGCCGTGTGGAGG + Intronic
1069952198 10:72026790-72026812 CTCTGCCAGGCCTCGGCTGGAGG - Intergenic
1072685598 10:97534813-97534835 CTCTGCCAGGGGTCAGATGGTGG - Intronic
1075670856 10:124263239-124263261 CCGTGCCAGGCATCTGCTTGTGG - Intergenic
1076983922 11:222174-222196 CCATGCTAGGCCTAGGATGGAGG - Intronic
1078124272 11:8544163-8544185 CCGTGCCTGTCGGGGGATGGGGG - Intronic
1081757808 11:45557059-45557081 AGGTGCCAGGCGTGGGATGGGGG + Intergenic
1085474819 11:76783256-76783278 CCCTGCCGGGCGCCGGGTGGCGG - Intronic
1095145568 12:38721983-38722005 CCTTGGCAGGCGTGGGATGCAGG + Intronic
1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG + Intronic
1118303232 14:64633528-64633550 CAGTGGCAGGCATAGGATGGTGG - Intergenic
1127982759 15:64046504-64046526 CCGTCCCAGGCGCCGGCTGGAGG + Intronic
1132016362 15:98320819-98320841 CCGTGCCAGGCGTGGGGAGGTGG + Intergenic
1142127641 16:88418123-88418145 CCCTGCCAGGCCCAGGATGGGGG + Intergenic
1142127869 16:88419209-88419231 CCGTGCCAAGCCACGGAAGGGGG + Intergenic
1147315347 17:39617773-39617795 CCGTGCCAGGCGCGGGGCGGGGG - Intergenic
1147400464 17:40177728-40177750 CCGTGCCAGGCGCCAGACTGGGG - Intronic
1157204844 18:45689182-45689204 ACGTGCCAGGCCTGGAATGGGGG - Intergenic
1162757171 19:12867356-12867378 CGGAGCCAGGCCTCGGAGGGTGG + Intronic
1163158716 19:15452558-15452580 CCGTGCTAGGCGTGGTTTGGGGG + Intronic
1164658520 19:29942255-29942277 CCCAGCCAGGCGTCGCGTGGCGG - Exonic
1165329727 19:35134767-35134789 GCGTGCCAGCAGGCGGATGGAGG - Exonic
1165900341 19:39166749-39166771 CCGTGCCAGGCCTGGGAAGAGGG - Intronic
1166564372 19:43754699-43754721 CCGTGACGGGAGTCGGGTGGGGG + Exonic
932257743 2:70301837-70301859 CAGTGCAAGGCGTCGCGTGGTGG + Intronic
935789995 2:106582200-106582222 CCCTGCCATGCGTGGGGTGGAGG - Intergenic
936110489 2:109660597-109660619 CCATGCCAGGAGGCAGATGGGGG + Intergenic
944433215 2:199659346-199659368 CCGCGCCCGGCGGCGGCTGGGGG - Intergenic
948866472 2:240777559-240777581 GCGTTCCAGGCTTGGGATGGTGG - Intronic
1172650854 20:36500431-36500453 TCGAGCCAGGGGTCGGGTGGGGG - Exonic
1174503562 20:51002762-51002784 CAGTGCCAGGCGTGGGGAGGGGG - Intergenic
1176029524 20:63005274-63005296 ACGTCCCAGGCAGCGGATGGCGG + Intergenic
1182128752 22:27835272-27835294 CACTGCCAGGCATAGGATGGAGG - Intergenic
1183284320 22:36952841-36952863 CTCTGCCTGGCGTGGGATGGTGG - Intergenic
1183290972 22:37001961-37001983 CCATGCCAGGGGACGGATGACGG - Exonic
1184184271 22:42853910-42853932 CCCTTCCGGGCGTGGGATGGTGG + Intronic
1184659660 22:45960059-45960081 CCATGCCAGGGGCAGGATGGTGG - Intronic
1184745443 22:46453078-46453100 CCCTGCCATGCCTCGGAGGGAGG + Intronic
983959190 4:173732027-173732049 CCGTGCCAGGCCTGGGATCAGGG - Intergenic
989607685 5:43260763-43260785 CCGGGCCTGTCGTCGGGTGGGGG - Intronic
990954666 5:61331003-61331025 GCGTGCCAGGCGGCGGACGGCGG - Intergenic
997456998 5:134025033-134025055 CTGTCCCAGGCGTGGGATGAGGG + Intergenic
999317068 5:150591053-150591075 AGGTGCCAGGCCTGGGATGGGGG + Intergenic
1000021484 5:157322708-157322730 CAGTGCCAGGCATGTGATGGGGG + Intronic
1001277182 5:170359478-170359500 GCGAGCCAGGACTCGGATGGTGG - Intronic
1001997023 5:176170315-176170337 CTGTGCCAGGCCTTGGATGTGGG - Intergenic
1002475346 5:179461982-179462004 CGGTGCCAGGCATGGGGTGGAGG - Intergenic
1003942497 6:11043791-11043813 CCGCTCCAGGCGTCGGCGGGCGG + Intronic
1005473929 6:26188957-26188979 GCGAGCCAGGCGGCGGATAGCGG + Exonic
1005479316 6:26240523-26240545 TCGGGCCAAGCGACGGATGGCGG - Exonic
1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG + Exonic
1019335605 7:481155-481177 CAGTGCCAGGCTTCGGAGAGGGG - Intergenic
1022043407 7:26602428-26602450 CAGTGCCAGGCATAGGATGGGGG + Intergenic
1029810049 7:103038146-103038168 CCGAGCCAGGCATGGGAGGGAGG - Intronic
1034345727 7:150384154-150384176 CAGGGCCAGGCGTGGGAAGGGGG + Intronic
1035117159 7:156534163-156534185 CAGTGCCGGGAGTGGGATGGTGG - Intergenic
1035522805 8:288807-288829 CAGTGCCAGGCATCGCAGGGTGG - Intergenic
1039518317 8:38151143-38151165 CAGGGCCAGGCGAGGGATGGAGG + Exonic
1046436233 8:114192937-114192959 CCGGGCCTGTCGTGGGATGGGGG + Intergenic
1057337334 9:94166285-94166307 CCGCGCCAGGACCCGGATGGAGG - Intergenic
1198128548 X:133671808-133671830 CGGGGCCTGGCGTGGGATGGGGG - Intronic