ID: 1005649467

View in Genome Browser
Species Human (GRCh38)
Location 6:27873397-27873419
Sequence CAGGCGTCGGATGGCGGGCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005649456_1005649467 23 Left 1005649456 6:27873351-27873373 CCTCGTATATAAGGCCTGAGATG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1005649467 6:27873397-27873419 CAGGCGTCGGATGGCGGGCTTGG 0: 1
1: 0
2: 1
3: 9
4: 90
1005649457_1005649467 9 Left 1005649457 6:27873365-27873387 CCTGAGATGCGCTTAACGCCTCC 0: 1
1: 0
2: 4
3: 5
4: 38
Right 1005649467 6:27873397-27873419 CAGGCGTCGGATGGCGGGCTTGG 0: 1
1: 0
2: 1
3: 9
4: 90
1005649459_1005649467 -9 Left 1005649459 6:27873383-27873405 CCTCCACGCCGTGCCAGGCGTCG 0: 1
1: 0
2: 0
3: 7
4: 156
Right 1005649467 6:27873397-27873419 CAGGCGTCGGATGGCGGGCTTGG 0: 1
1: 0
2: 1
3: 9
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005649467 Original CRISPR CAGGCGTCGGATGGCGGGCT TGG Exonic
900943194 1:5814407-5814429 CAGGGGGCGGGTGGCAGGCTGGG + Intergenic
919381021 1:196861474-196861496 CAGGCATCTGCTGGGGGGCTTGG - Intronic
920061447 1:203229587-203229609 GAGCCGTCGGATAGTGGGCTGGG - Intronic
1063662481 10:8043876-8043898 CAGGGGTTGGCTGACGGGCTGGG + Intergenic
1063953809 10:11247600-11247622 CAGGGGTGGGATGGCGGGCATGG - Intronic
1067582826 10:47456271-47456293 CAGGCGTCTGATGCCATGCTGGG - Intergenic
1069912185 10:71766355-71766377 CAGGTGGCGGGTGGCGGGCGGGG - Intronic
1074364198 10:112845162-112845184 CAGGCGTGGAATGGTGGACTCGG - Intergenic
1076732455 10:132445523-132445545 CAGGAGGCTGAGGGCGGGCTGGG + Intronic
1076995320 11:294827-294849 CAGGTGAGGGATGGCAGGCTAGG - Exonic
1077107722 11:849324-849346 CCGGCGGCGGGTGGGGGGCTGGG - Intronic
1077107937 11:849948-849970 CAGGCGCCGGCCGGCGGGATGGG + Intronic
1077828391 11:5835709-5835731 CAGTCGTGGCATGGGGGGCTGGG - Intronic
1082988609 11:59188245-59188267 CTGGCGTGGGATGGAGGGGTGGG + Intronic
1084235562 11:67785970-67785992 CAGGCCTCGGATGGCAGGGGTGG + Intergenic
1084693045 11:70738000-70738022 CAGGAGCCGGGTGCCGGGCTCGG + Intronic
1091313928 11:134597492-134597514 CAGGCGCGGGAGGGCGGGCTGGG + Intergenic
1092455099 12:8636059-8636081 CGGGTGTCGGGTGTCGGGCTGGG - Intergenic
1092532923 12:9360267-9360289 AAGGGGTCGGATGGGGGGCTGGG - Intergenic
1094466041 12:30754785-30754807 CAGGCTTTGGAAGGCGGGCCCGG - Intronic
1096675138 12:53221991-53222013 TAGGCGAGGGATGGCGGGCGCGG + Intronic
1098426055 12:70366511-70366533 CAGGCGGCGGCTGGGGGGCTGGG + Exonic
1108717864 13:53099640-53099662 CAGGCATCTGGTGGTGGGCTTGG + Intergenic
1118092174 14:62494504-62494526 CTGTCGTGGGATGGGGGGCTAGG - Intergenic
1122941135 14:104981892-104981914 CAGGCTTCAGCTGGCGGGCAGGG - Intergenic
1124412192 15:29445726-29445748 CAGGAGTGGGATGGCTGGCATGG - Intronic
1129351165 15:74956699-74956721 CAGACGCCGGCGGGCGGGCTGGG + Exonic
1131274999 15:90973504-90973526 CAGACGACGGGTGTCGGGCTGGG - Intronic
1132227342 15:100152584-100152606 CAGCCGTGGGAGGGCTGGCTCGG - Intronic
1135910105 16:26552532-26552554 CAGGCGTCTGGTGGCAGGCAGGG + Intergenic
1136188294 16:28600886-28600908 CAGGCGGCGGCAGGCGGGCAAGG - Intergenic
1136190766 16:28613880-28613902 CAGGCGGCGGCAGGCGGGCAAGG - Intronic
1138765119 16:59592715-59592737 CAGGCATCCGATGGGGGCCTTGG + Intergenic
1141959158 16:87392722-87392744 CAGCCGGCGGAGGGCGGGCGGGG + Intronic
1142132496 16:88437395-88437417 CAGGGGTCGGGGGACGGGCTGGG - Exonic
1142251194 16:88992829-88992851 CAGGCAGCTGATGGGGGGCTGGG - Intergenic
1142639895 17:1279859-1279881 CAGGAGACGGAGGGCCGGCTGGG - Exonic
1151539569 17:74758219-74758241 CAGGGAGCGGATGGCGGGCACGG - Intronic
1152303447 17:79508382-79508404 CAGGCGGAGGAGGTCGGGCTGGG - Intronic
1152697424 17:81804087-81804109 GCGGCGGCGGAGGGCGGGCTCGG - Intergenic
1154210781 18:12377130-12377152 CAGGCGACGACTGGCGGCCTCGG + Exonic
1160387101 18:78503382-78503404 CAGGGCTCGGATGGGGTGCTGGG + Intergenic
1163293741 19:16398446-16398468 CAAGCGTCTGATGGGGGTCTCGG + Intronic
1164398739 19:27888327-27888349 CAGGCCTGGGATTGCAGGCTGGG + Intergenic
1165213704 19:34254638-34254660 CAGGCGGGGGCTGGCGGGCGGGG + Intronic
1165349173 19:35267259-35267281 CAGGCGGGGGCTGGCGGGCCAGG + Exonic
1168315971 19:55484972-55484994 CAGGAGACGGGCGGCGGGCTGGG - Intergenic
937146328 2:119648189-119648211 CAAGTGTCAGATAGCGGGCTAGG - Intronic
938391871 2:130913078-130913100 CAGGCATCGGCTGGGGGTCTTGG + Intronic
941810623 2:169752783-169752805 CAGGCGTGGGATTACAGGCTGGG - Intronic
1169247425 20:4034539-4034561 CGGGTGTCGGGTGTCGGGCTGGG + Intergenic
1179602875 21:42492369-42492391 CATCCGTCAGATGGCGGGGTTGG + Intronic
1183020761 22:35024171-35024193 TTGGCGTCGGATGGCGGGGTTGG - Intergenic
1183201407 22:36387752-36387774 CAGGCGGCGGCGGGCGGGCGGGG - Intronic
1183945658 22:41324428-41324450 AAGGCATCGGATGCAGGGCTGGG - Intronic
952783738 3:37131109-37131131 CAGGCATCTGCTGGGGGGCTTGG + Intronic
953450977 3:43005947-43005969 CAGGCATCCGCTGGGGGGCTTGG + Intronic
956642398 3:71427479-71427501 AAGGCCCCGGATGCCGGGCTAGG + Intronic
961302947 3:125933828-125933850 CAGGCCTCGGATGGCAGGGGTGG - Intronic
961452731 3:127009672-127009694 CAGGGGGCGGATGGTGGCCTTGG - Intronic
967176546 3:186866043-186866065 CGGGTGTCGGGTGTCGGGCTGGG + Intergenic
967963192 3:194941511-194941533 CAAGCCTTGGATGGCAGGCTAGG + Intergenic
969652545 4:8476332-8476354 CAGGCGTCGGACAGCGCCCTGGG - Exonic
969819620 4:9710090-9710112 CAGGCCTCGGATGGCAGGGGTGG - Intergenic
970144645 4:13022290-13022312 CAGGGGTAGGGTGGGGGGCTAGG + Intergenic
976928037 4:90526546-90526568 CAGGTGGGGGATGGTGGGCTAGG - Intronic
977511828 4:97971642-97971664 CTGTCGTGGGGTGGCGGGCTGGG + Intronic
986648274 5:9939595-9939617 CTTGCATGGGATGGCGGGCTGGG + Intergenic
990954664 5:61330997-61331019 CAGGCGGCGGACGGCGGCTTCGG - Intergenic
992183402 5:74220436-74220458 CTGTCGTTGGATGGGGGGCTGGG + Intergenic
997457291 5:134026773-134026795 CAGGCTTGGGGTGACGGGCTTGG - Intergenic
1000516494 5:162241498-162241520 TAGGCATCGGATGGAGGGCGTGG + Intergenic
1005456178 6:26021770-26021792 CAGACGCCGGATGGCCGGCTTGG - Exonic
1005473932 6:26188963-26188985 CAGGCGGCGGATAGCGGGCTTGG + Exonic
1005475610 6:26204736-26204758 AAGGCGCCGGATGGCAGGCTTGG - Exonic
1005570354 6:27139400-27139422 AAGGCGCCGAATGGCTGGCTTGG - Exonic
1005643986 6:27824216-27824238 AAGGCGCCGGATGGCCGGCTTGG - Exonic
1005645211 6:27831414-27831436 AAGGCGCCGGATGGCCGGCTTGG + Exonic
1005649467 6:27873397-27873419 CAGGCGTCGGATGGCGGGCTTGG + Exonic
1017660898 6:156671398-156671420 CAGTCGTGGGGTGGGGGGCTAGG + Intergenic
1017950729 6:159132870-159132892 CAGGCGTGGGGTGGAGGGCAGGG - Intergenic
1019330375 7:457935-457957 CAGGCCTCGGGTGAGGGGCTGGG + Intergenic
1021937646 7:25646871-25646893 TAGGGGTGGGATGGCGGGGTTGG + Intergenic
1023474165 7:40558594-40558616 CAGGCTTCGGTTGGTGGGGTGGG + Intronic
1025853649 7:65260698-65260720 CGGGTGTCGGGTGTCGGGCTGGG + Intergenic
1026663189 7:72320234-72320256 CAGGGCTAGGACGGCGGGCTAGG + Intronic
1034537236 7:151733062-151733084 CAGGCTTGGGAGGGAGGGCTTGG + Intronic
1039903274 8:41767698-41767720 CAGGTGCCGGCCGGCGGGCTCGG + Intronic
1041693597 8:60714080-60714102 CAGGCCTCGGCGGGCGGGGTGGG + Intronic
1043038462 8:75228816-75228838 CAGGCGTCCGCTGGGAGGCTTGG + Intergenic
1047506642 8:125485805-125485827 CAGGCATCTGATGGGAGGCTGGG - Intergenic
1053656473 9:40222394-40222416 CAGGCGTGAGCTGGCGGGCCTGG - Intergenic
1055085154 9:72306192-72306214 CAGGCATCTAATGGGGGGCTTGG - Intergenic
1058351666 9:104032481-104032503 CAGGGGTTGGTGGGCGGGCTGGG - Intergenic
1062353180 9:136148970-136148992 CTGGCGTTGGACGGCGGGGTGGG + Intergenic
1185505619 X:630725-630747 CAGGCAGCGCATGGGGGGCTGGG + Exonic
1192179504 X:68907545-68907567 GAGGTGTGGGATGGGGGGCTTGG + Intergenic
1195405930 X:104513249-104513271 CAGGAGTCTGATTGCAGGCTGGG + Intergenic
1196791410 X:119468370-119468392 CAGGCGTCGGAGGCGGGGCCGGG - Intergenic
1197648223 X:129039985-129040007 CAGGCTTCACAGGGCGGGCTTGG - Intergenic
1201161772 Y:11172544-11172566 CCGGCGTCAGCTGGCGGGCCTGG - Intergenic