ID: 1005650180

View in Genome Browser
Species Human (GRCh38)
Location 6:27878801-27878823
Sequence ACACTCCCACCAAGCCATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005650177_1005650180 13 Left 1005650177 6:27878765-27878787 CCTAGAAAGCAGGGGCTTCATGC No data
Right 1005650180 6:27878801-27878823 ACACTCCCACCAAGCCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005650180 Original CRISPR ACACTCCCACCAAGCCATCC TGG Intergenic
No off target data available for this crispr