ID: 1005652650

View in Genome Browser
Species Human (GRCh38)
Location 6:27898563-27898585
Sequence CACCTTGGCCTCTGAAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005652640_1005652650 25 Left 1005652640 6:27898515-27898537 CCATGTTGGCCAGGCTGGTCTGG 0: 3066
1: 84439
2: 178948
3: 204769
4: 121032
Right 1005652650 6:27898563-27898585 CACCTTGGCCTCTGAAAGCTGGG No data
1005652642_1005652650 16 Left 1005652642 6:27898524-27898546 CCAGGCTGGTCTGGAACTCCTGG 0: 1456
1: 33996
2: 167552
3: 198686
4: 191860
Right 1005652650 6:27898563-27898585 CACCTTGGCCTCTGAAAGCTGGG No data
1005652644_1005652650 -2 Left 1005652644 6:27898542-27898564 CCTGGACTCAAGTGATCCACCCA 0: 146
1: 3857
2: 27049
3: 81698
4: 149659
Right 1005652650 6:27898563-27898585 CACCTTGGCCTCTGAAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005652650 Original CRISPR CACCTTGGCCTCTGAAAGCT GGG Intergenic
No off target data available for this crispr