ID: 1005653805

View in Genome Browser
Species Human (GRCh38)
Location 6:27911509-27911531
Sequence TTCACCCAGCTCCAAAGACC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005653805_1005653810 -4 Left 1005653805 6:27911509-27911531 CCCGGTCTTTGGAGCTGGGTGAA 0: 1
1: 0
2: 1
3: 13
4: 170
Right 1005653810 6:27911528-27911550 TGAAGGTGGTTGCAGGTACATGG 0: 1
1: 0
2: 2
3: 19
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005653805 Original CRISPR TTCACCCAGCTCCAAAGACC GGG (reversed) Exonic
901004662 1:6165979-6166001 CACACCCAGCTCCACAGACCCGG + Intronic
901338237 1:8470500-8470522 TCCACCCACCTCCAAAGTGCTGG + Intronic
901447423 1:9316829-9316851 TTCTCCCTGCTCCTATGACCTGG + Intronic
901763919 1:11488114-11488136 TGCTCCCAGCCCCAAAGGCCAGG - Intronic
907393301 1:54172751-54172773 TTGACTCAGCTCCAAATAGCGGG - Intronic
910179342 1:84464070-84464092 TCCACTCAGCTCCACAGGCCAGG + Intergenic
912251641 1:108018050-108018072 TTCACCCAGTTCAAAAGCCCTGG - Intergenic
912453975 1:109785671-109785693 TTGAGCCTGCACCAAAGACCAGG + Intergenic
914392897 1:147237580-147237602 TTCCCCCAGCTCCATGGAGCTGG + Intronic
915192575 1:154164106-154164128 TTCCCCCAGCTCCCCAAACCAGG + Intronic
919843114 1:201623441-201623463 CTCATCAGGCTCCAAAGACCTGG - Intronic
922941156 1:229467682-229467704 TCCACCCACCTCCAAAGTGCTGG - Intronic
1067161214 10:43826318-43826340 TTCACCCAGCGCCTGTGACCCGG + Intergenic
1067281420 10:44876424-44876446 TTCATACAGCTCTAAAGACAAGG + Intergenic
1070660857 10:78304281-78304303 TTAGCCCAGCTCCAAAGTCAGGG - Intergenic
1072609238 10:97005440-97005462 TATGCCCAGCTCCACAGACCAGG - Intronic
1074692725 10:116021163-116021185 TTCTCTCAGATCCAAAGACTTGG - Intergenic
1075189701 10:120295582-120295604 TTCATCAAGCTGCATAGACCCGG + Intergenic
1076445875 10:130513414-130513436 TTCATTCAGCTACACAGACCTGG - Intergenic
1077114020 11:875006-875028 TGCAGCCAGCTCCAAGGAACGGG + Intronic
1077663665 11:4090516-4090538 TTCACCCACCCCAAAAGGCCAGG - Intronic
1081428195 11:42948434-42948456 GCCACCCAGCTCCTAGGACCTGG + Intergenic
1083791496 11:64989106-64989128 CCAACCCAGCTCCGAAGACCAGG + Exonic
1084587152 11:70068937-70068959 CTCATCCAGCTCCAAGGACCAGG + Intergenic
1085507703 11:77069609-77069631 CTCCCCCAGCTGCAAAGAGCAGG + Intronic
1085780141 11:79400865-79400887 TACACTCAGCTCCAGAGAACTGG + Intronic
1089047520 11:115516094-115516116 TTTACCCAACTTCAAAGACCAGG - Intergenic
1089335543 11:117720465-117720487 TGGAGCCAGCTCCAAAGGCCGGG - Intronic
1090140245 11:124250464-124250486 TTCAATCAGCTCCATGGACCAGG + Exonic
1092398773 12:8153641-8153663 TTCACCCAGTTCCAAATTCCTGG + Intronic
1094409658 12:30155692-30155714 TTCACCCAGGCCCAAGCACCTGG - Intergenic
1094441139 12:30478338-30478360 TTCTCCCAGCTACAAAGTCATGG - Intergenic
1094749308 12:33387093-33387115 TGCACCCAGGTCCACAGAGCTGG + Intronic
1095928507 12:47603442-47603464 TTCACCCTGCTCCAGAAATCTGG + Intergenic
1100653576 12:96617100-96617122 TTCACCCAACTGCCCAGACCAGG - Intronic
1102004203 12:109578600-109578622 TTCTCCTAGCCCCAAAGTCCAGG + Intronic
1103447561 12:121004110-121004132 CTCAGCCAGCTCCAAGGACAAGG - Exonic
1105249508 13:18685294-18685316 TTTACCCCTCTCCAATGACCAGG - Intergenic
1109244707 13:59939638-59939660 TTTACCCAGGACCAGAGACCAGG + Intronic
1110917881 13:81046100-81046122 TTCACCCAGATCAAAAGACATGG - Intergenic
1111787155 13:92803342-92803364 TTCACCAACCTCAAAAGACAGGG + Intronic
1112245545 13:97730126-97730148 TTCTCCCAGCTCCAAACAACAGG + Intergenic
1112292836 13:98160162-98160184 ATCACCAAGCTCCAAAGACATGG - Intronic
1112595690 13:100804922-100804944 TTCTCCCAGTTCCCAAGAGCTGG - Intergenic
1116760500 14:49006941-49006963 TTCACCCAGCTCAAAAATCTAGG - Intergenic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1125784314 15:42301734-42301756 TCCACCCAGCTCAAAATTCCAGG - Intronic
1127869551 15:63059920-63059942 CTCCCCCAGCCACAAAGACCCGG + Intronic
1128636190 15:69303962-69303984 TTCCCCCAGCTCCAAGGTTCAGG - Intronic
1129589983 15:76906215-76906237 TTCACCCTGCTCCAAGAAGCCGG - Intergenic
1129763677 15:78147694-78147716 TCCTTCCAGCCCCAAAGACCTGG - Intronic
1130672373 15:85923818-85923840 TTCCCCCAGGTACAAAGCCCAGG - Intergenic
1132364276 15:101245237-101245259 TACACCTAGCCCCAAAGAGCTGG + Intronic
1134746799 16:16594981-16595003 TTCATCCAGCCCCACATACCTGG + Intergenic
1134998675 16:18758682-18758704 TTCATCCAGCCCCACATACCTGG - Intergenic
1141321826 16:83018084-83018106 TTCACCACACTCCAAAGGCCAGG - Intronic
1143615671 17:8047795-8047817 ACCACCCACCTCCAAAGGCCTGG + Exonic
1145845181 17:28032433-28032455 TTATCCCAGCTCCAAACCCCAGG - Intergenic
1150327436 17:64268320-64268342 TCCATCCAACTCCACAGACCTGG - Intergenic
1151851472 17:76692892-76692914 TTCACCAGGTTCCAAAGAACTGG + Intronic
1152463334 17:80452502-80452524 TCCACCCAGTTCCAAAGTCAGGG - Intergenic
1152808067 17:82366921-82366943 CTCACCCTTCTCCAGAGACCTGG + Intergenic
1154439323 18:14373591-14373613 TTTACCCCTCTCCAATGACCAGG + Intergenic
1160983600 19:1827612-1827634 TGCCCCCAGCTGCAAAGACGGGG - Exonic
1161585824 19:5104965-5104987 CTGACCCAGCTCCAAACTCCCGG - Intronic
1164825495 19:31282233-31282255 TTCACCCATCTACACAGGCCTGG - Intronic
1165069954 19:33249365-33249387 TGCACCCAGCTCCTCCGACCCGG + Intergenic
1165924768 19:39320361-39320383 CACACCCGGCTCCACAGACCCGG + Intergenic
1166435281 19:42762307-42762329 TGCCCCCAGCTCCACAGTCCAGG + Intronic
1166452546 19:42914510-42914532 TGCCCCCAGCTCCACAGTCCAGG + Intronic
1166657522 19:44623142-44623164 TTCACCCAGATCCAGAGGCGAGG + Intronic
1168459222 19:56539335-56539357 CTCCACCAGCTTCAAAGACCAGG - Intronic
927234364 2:20856657-20856679 ATCATACAGCTCCAAAGTCCAGG - Intergenic
927486917 2:23494961-23494983 CTCACCCAGCCCCAAGCACCTGG + Intronic
927902583 2:26831499-26831521 TCCAACCAGCTACCAAGACCTGG - Intergenic
929232009 2:39569627-39569649 TTCTCCCAGCTCTGAAGACTGGG - Intergenic
934020542 2:87947190-87947212 TGCACTCAGCTCCATAGGCCAGG + Intergenic
936240179 2:110781256-110781278 TCCACCCAGCCCCAAATATCAGG - Intronic
937522989 2:122734393-122734415 TTCACCCAGCTCTCAGGAGCAGG - Intergenic
937578473 2:123454454-123454476 TTCCCACAGTTCCAAAGGCCAGG - Intergenic
940302499 2:152189872-152189894 TTCCCACAGCTCCAAAGGCCTGG + Intergenic
941516512 2:166486918-166486940 TTCCCTCAGCTCTAATGACCTGG + Exonic
943103331 2:183512258-183512280 TGCTCCCAGCTCCAAAGAGTTGG + Intergenic
946388839 2:219403152-219403174 ATCACACATTTCCAAAGACCTGG - Intergenic
947192880 2:227527130-227527152 TTGTCCCAACTCCAAAGCCCAGG - Intronic
947930919 2:233964611-233964633 TTCACCCCCCTAAAAAGACCAGG + Exonic
1169795515 20:9458782-9458804 GTCACCCAGCTTCAAGGAGCTGG + Intronic
1171188609 20:23142011-23142033 TGCACGCAGCTCCCAAGAGCTGG + Intergenic
1171357916 20:24564855-24564877 TTCAGCCAGCTCCAAGTTCCAGG - Intronic
1172169618 20:32921072-32921094 ATCACCCAGGTCCAGGGACCAGG + Intronic
1175444198 20:59008863-59008885 TTCACCCAGATTCAGGGACCAGG - Intergenic
1175523243 20:59616415-59616437 TTCACCCAGCAGCTCAGACCAGG - Intronic
1176456359 21:6915817-6915839 TTTACCCTTCTCCAATGACCAGG - Intergenic
1176834533 21:13780877-13780899 TTTACCCTTCTCCAATGACCAGG - Intergenic
1179128573 21:38614130-38614152 TTGACTCAGAGCCAAAGACCAGG + Intronic
1179714890 21:43281533-43281555 TTCTCCCAGCACCACAGCCCCGG - Intergenic
1182811891 22:33123827-33123849 TTCACCCAGTTCCACAAGCCTGG - Intergenic
1183641887 22:39097657-39097679 TTCTCCCAGTTCCAGAGCCCAGG - Intronic
1184094219 22:42307924-42307946 ATCTCCCAGCTCCACAGCCCTGG + Intronic
1185237051 22:49720301-49720323 TTCACAAAGCTCCCAAGTCCAGG + Intergenic
1185282548 22:49981085-49981107 TTCCCCCTGGTCCTAAGACCAGG + Intergenic
951417613 3:22444207-22444229 TACAGCCAGCTCAAAAGACATGG + Intergenic
951619234 3:24582916-24582938 TTCACTAAGCTCTAAAGACCTGG + Intergenic
952838154 3:37621943-37621965 TTGACAGAGCTCCAAAAACCAGG - Intronic
954625784 3:52021245-52021267 CTCTACCAGCTCCAAAGGCCAGG - Intergenic
957578127 3:82035333-82035355 TTCAACCACCACCAAAGTCCAGG + Intergenic
964736303 3:159922147-159922169 GACACCCAGCTTCAGAGACCAGG - Intergenic
966849670 3:184156594-184156616 TCCACCCAGCTGCAGAGATCTGG + Intronic
967535695 3:190600309-190600331 TTCACTCAGCTCCAAGGATGAGG - Intronic
968815608 4:2820139-2820161 AGCACCCAGCTCAAACGACCTGG - Intronic
969406540 4:6996741-6996763 GGCACCCAGCTCCAAAGCCTGGG - Intronic
969698212 4:8747953-8747975 TTCAGCAAGCTCCAAAGCCTCGG + Intergenic
970980538 4:22091502-22091524 TCCACCCACCACCAAAGCCCAGG - Intergenic
971750435 4:30640232-30640254 TTCACCCAGCTTCTAAGTCCAGG + Intergenic
971859358 4:32085365-32085387 TTCACCCAGCTGCAGACAACTGG - Intergenic
973218749 4:47701172-47701194 TTCACCTTGCTGCAAAGACAAGG + Intronic
974349732 4:60729588-60729610 TTCATCAAACTCCAAAGACCTGG + Intergenic
975357909 4:73429850-73429872 TTCTCACAGTTCCAGAGACCAGG - Intergenic
975478175 4:74846530-74846552 TTCACCCTGCTCCAGCAACCTGG + Intergenic
975974896 4:80083909-80083931 TCCTCACAGCTCCAAAGACTGGG + Intronic
980567639 4:134564917-134564939 TTCCCCCAACCCCAAAGCCCTGG + Intergenic
980908263 4:138970414-138970436 TTGACACAGCTGGAAAGACCTGG + Intergenic
986739908 5:10696876-10696898 TTCCCCCAGCACCAAAGAGTGGG + Intronic
988361973 5:30247907-30247929 TTCTCACAGTTCCAAAGGCCAGG - Intergenic
991094993 5:62730731-62730753 TACACGCAGCTACAAAGACTAGG - Intergenic
995059303 5:107796243-107796265 TTCACTCAGAGCCAAAGGCCAGG - Intergenic
997303949 5:132825253-132825275 ATCACCGAGCTTCAAGGACCCGG + Exonic
1000319170 5:160119806-160119828 TTCTCCCACCTCCAAAGACCTGG - Intergenic
1002106790 5:176883307-176883329 CCCGCCCAGCTCCAAACACCAGG + Intronic
1002292987 5:178212279-178212301 CTCCCCCAGCTCCAGAGCCCTGG + Intronic
1003415704 6:5905993-5906015 TTCCCCCAGAACAAAAGACCTGG + Intergenic
1003790408 6:9540234-9540256 CTCACCAAGCACCAAAAACCTGG - Intergenic
1005653805 6:27911509-27911531 TTCACCCAGCTCCAAAGACCGGG - Exonic
1006800399 6:36756210-36756232 TACACCCGGCTGCAGAGACCGGG + Intronic
1013977130 6:116091767-116091789 TGCTCCCAACTCCAAAGAGCCGG - Intergenic
1014198554 6:118584623-118584645 TTAACACAGGCCCAAAGACCAGG + Intronic
1015820975 6:137259947-137259969 TTCTCACAGTTCCAGAGACCGGG + Intergenic
1017875240 6:158518645-158518667 TTTACCCAGCAGCAAGGACCTGG - Intergenic
1022070472 7:26908714-26908736 TTCCCCCAGCTCTCAAGTCCTGG - Intronic
1022140977 7:27492534-27492556 TGCACCCTGCTGCAAAGACTGGG + Intergenic
1022515868 7:30974684-30974706 TTCCCCCAGCCCCACAGCCCTGG - Intronic
1032887343 7:136154955-136154977 TTCATCCTGCTGCAAACACCAGG - Intergenic
1037507421 8:19545019-19545041 ATAACTTAGCTCCAAAGACCAGG + Intronic
1040286383 8:46102641-46102663 GTCACCCTGCTCCAAAGCCTAGG + Intergenic
1040286959 8:46105390-46105412 GTCACCCTGCTCCAAAGCCTGGG + Intergenic
1040289700 8:46117971-46117993 GTCACCCTGCTCCAAAGCCTGGG + Intergenic
1040290438 8:46121433-46121455 GTCACCCTGCTCCAAAGCCTGGG + Intergenic
1040293135 8:46135686-46135708 GGCACCCTGCTCCAAAGACTGGG + Intergenic
1040295319 8:46145988-46146010 GTCACCCCGCTCCAAAGCCTGGG + Intergenic
1040296330 8:46150978-46151000 TCCACCCTGCTCCAAAGCCAGGG + Intergenic
1040302371 8:46194724-46194746 TGCACCCTGCTCCAAAGCCTGGG - Intergenic
1040302710 8:46196205-46196227 GGCACCCTGCTCCAAAGACTGGG - Intergenic
1040304261 8:46203857-46203879 GGCACCCAGCTCCAAAGCCTGGG - Intergenic
1040305110 8:46208014-46208036 GTCACCCTGCTCCAAAGCCTGGG - Intergenic
1040307791 8:46221172-46221194 GGCACCCTGCTCCAAAGACTGGG - Intergenic
1040311963 8:46241411-46241433 GACACCCAGCTCCAAAGCCCAGG - Intergenic
1040313567 8:46249296-46249318 TGCACCCTGCTGCAAAGCCCGGG - Intergenic
1040315455 8:46258519-46258541 GTCACCCTGCTCCAAAGCCTGGG - Intergenic
1040325099 8:46337642-46337664 GTCACCCTGCTTCAAAGACTGGG - Intergenic
1040330075 8:46381384-46381406 GGCACCCTGCTCCAAAGACTGGG - Intergenic
1040332074 8:46390814-46390836 GGCACCCTGCTCCAAAGACTGGG - Intergenic
1040335233 8:46412704-46412726 GGCACCCAGCTCCAAAGCCTGGG - Intergenic
1040338882 8:46429924-46429946 GTCACCCTGCTCCAAAGCCTGGG - Intergenic
1040338982 8:46430357-46430379 GTCACCCTGCTCCAAAGCCTGGG - Intergenic
1040339321 8:46432472-46432494 GTCACCCTGCTCCAAAGCCTGGG - Intergenic
1044759963 8:95507426-95507448 GTCTCCCAGCTCCCAACACCAGG - Intergenic
1046779590 8:118200974-118200996 TACACCCAGCTACACACACCTGG + Intronic
1047001789 8:120580514-120580536 TTCCCCCAGCTCCCATGAGCAGG + Intronic
1051265393 9:15304688-15304710 TTCTTCCAGCTCTAAAGATCTGG - Intronic
1051769438 9:20560500-20560522 TTTATCTAGCTCCAAAGAGCAGG - Intronic
1058381725 9:104384244-104384266 TTCCCCCAGCTGCAGAAACCTGG + Intergenic
1059299111 9:113298482-113298504 TGCGTCCAGCTCCAAAGCCCAGG - Exonic
1060187386 9:121572016-121572038 TTCACACAGCTCCAAGGGGCTGG - Intronic
1060452748 9:123758470-123758492 TTCACACAGCTACAAAGAGGAGG + Intronic
1061445530 9:130635182-130635204 AGCACCCAGCTCCAATGCCCAGG - Intronic
1185761630 X:2693056-2693078 CTCACTCTGCTCCAATGACCTGG - Intronic
1186602746 X:11055979-11056001 TTTACCCAGCTTCAAACATCTGG + Intergenic
1190607026 X:52154186-52154208 TGCCCCCACCTCCAATGACCTGG + Intergenic
1190622415 X:52300519-52300541 TTCATCCAGCTCCATAGCCTAGG - Intergenic
1191885173 X:65880842-65880864 TCCACAAAGCTCCAGAGACCAGG - Intergenic
1196590501 X:117481553-117481575 GTCACCCAACTCCAGTGACCTGG - Intergenic
1197104978 X:122703000-122703022 GTCATCCAGTTGCAAAGACCTGG - Intergenic
1197158982 X:123302499-123302521 GTCACCCAGCTTCTAAGTCCTGG - Intronic
1198567620 X:137920924-137920946 TCCACCCAGCTCAGTAGACCAGG - Intergenic
1199123979 X:144091939-144091961 TGCACTCAGCTCCATAGGCCAGG - Intergenic