ID: 1005662433

View in Genome Browser
Species Human (GRCh38)
Location 6:28012402-28012424
Sequence CTAGTCTACCAGCATGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005662433_1005662437 6 Left 1005662433 6:28012402-28012424 CCTCTGGCATGCTGGTAGACTAG No data
Right 1005662437 6:28012431-28012453 CTCAACTTATTGTTTTCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005662433 Original CRISPR CTAGTCTACCAGCATGCCAG AGG (reversed) Intergenic
No off target data available for this crispr