ID: 1005664250

View in Genome Browser
Species Human (GRCh38)
Location 6:28034558-28034580
Sequence CAATGTAGCTATAAGAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005664250_1005664253 11 Left 1005664250 6:28034558-28034580 CCTCATCTCTTATAGCTACATTG No data
Right 1005664253 6:28034592-28034614 CTGAGAATCAAGTCAGCCGCAGG No data
1005664250_1005664255 22 Left 1005664250 6:28034558-28034580 CCTCATCTCTTATAGCTACATTG No data
Right 1005664255 6:28034603-28034625 GTCAGCCGCAGGAAGAAGGAAGG No data
1005664250_1005664254 18 Left 1005664250 6:28034558-28034580 CCTCATCTCTTATAGCTACATTG No data
Right 1005664254 6:28034599-28034621 TCAAGTCAGCCGCAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005664250 Original CRISPR CAATGTAGCTATAAGAGATG AGG (reversed) Intergenic
No off target data available for this crispr