ID: 1005664251

View in Genome Browser
Species Human (GRCh38)
Location 6:28034581-28034603
Sequence CTTGATTCTCAGCACTGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005664251_1005664254 -5 Left 1005664251 6:28034581-28034603 CCCTAGCAGTGCTGAGAATCAAG No data
Right 1005664254 6:28034599-28034621 TCAAGTCAGCCGCAGGAAGAAGG No data
1005664251_1005664255 -1 Left 1005664251 6:28034581-28034603 CCCTAGCAGTGCTGAGAATCAAG No data
Right 1005664255 6:28034603-28034625 GTCAGCCGCAGGAAGAAGGAAGG No data
1005664251_1005664258 16 Left 1005664251 6:28034581-28034603 CCCTAGCAGTGCTGAGAATCAAG No data
Right 1005664258 6:28034620-28034642 GGAAGGCCTTCAATATGTGCGGG No data
1005664251_1005664257 15 Left 1005664251 6:28034581-28034603 CCCTAGCAGTGCTGAGAATCAAG No data
Right 1005664257 6:28034619-28034641 AGGAAGGCCTTCAATATGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005664251 Original CRISPR CTTGATTCTCAGCACTGCTA GGG (reversed) Intergenic
No off target data available for this crispr