ID: 1005664255

View in Genome Browser
Species Human (GRCh38)
Location 6:28034603-28034625
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005664252_1005664255 -2 Left 1005664252 6:28034582-28034604 CCTAGCAGTGCTGAGAATCAAGT No data
Right 1005664255 6:28034603-28034625 GTCAGCCGCAGGAAGAAGGAAGG No data
1005664251_1005664255 -1 Left 1005664251 6:28034581-28034603 CCCTAGCAGTGCTGAGAATCAAG No data
Right 1005664255 6:28034603-28034625 GTCAGCCGCAGGAAGAAGGAAGG No data
1005664250_1005664255 22 Left 1005664250 6:28034558-28034580 CCTCATCTCTTATAGCTACATTG No data
Right 1005664255 6:28034603-28034625 GTCAGCCGCAGGAAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005664255 Original CRISPR GTCAGCCGCAGGAAGAAGGA AGG Intergenic