ID: 1005664257

View in Genome Browser
Species Human (GRCh38)
Location 6:28034619-28034641
Sequence AGGAAGGCCTTCAATATGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005664251_1005664257 15 Left 1005664251 6:28034581-28034603 CCCTAGCAGTGCTGAGAATCAAG No data
Right 1005664257 6:28034619-28034641 AGGAAGGCCTTCAATATGTGCGG No data
1005664252_1005664257 14 Left 1005664252 6:28034582-28034604 CCTAGCAGTGCTGAGAATCAAGT No data
Right 1005664257 6:28034619-28034641 AGGAAGGCCTTCAATATGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005664257 Original CRISPR AGGAAGGCCTTCAATATGTG CGG Intergenic
No off target data available for this crispr