ID: 1005664258

View in Genome Browser
Species Human (GRCh38)
Location 6:28034620-28034642
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005664252_1005664258 15 Left 1005664252 6:28034582-28034604 CCTAGCAGTGCTGAGAATCAAGT No data
Right 1005664258 6:28034620-28034642 GGAAGGCCTTCAATATGTGCGGG No data
1005664251_1005664258 16 Left 1005664251 6:28034581-28034603 CCCTAGCAGTGCTGAGAATCAAG No data
Right 1005664258 6:28034620-28034642 GGAAGGCCTTCAATATGTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005664258 Original CRISPR GGAAGGCCTTCAATATGTGC GGG Intergenic